Description :
From Genome Similarity Track
Location :
Scaffold_1536:524- 2941
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1536-snap-gene-0.10Protein phosphatase 2C
Pytar_ATCC12531maker-par_contig_1536-fgenesh-gene-0.4Ribosomal protein L15

Sequence
2417 bases(100 bases per row)
TATTAACCACACTCACGTCGTTCAGTCGAAGAATACGACCACGCACGTGATATTATCACAGGTCTCTCTCTTCATGGCTTCGTTGACGACGACCTCGGCT
GCTCGCGGCTGCTCGTGGAGTGGAAGACGAAGCACCATGTCCACCGCTTCTTGGTCGGTCATCACATCCCACACACCGTCACACGCGAGGATGAGAAACG
GATACTCGTCCGATGAGCTCAGGCTAAGAAGAAACAAGAAGAACGTTTGAGCATCCTGAACCAACTGGCTGCGAGGCTCCTCATTCTCACCGCGTGACTG
TTGTAGTAGGTGTCGCCGAAACGAACTGCTTGATTTCAAAGTCTCCGAAACTCCTGAAAGAATTGTCTTCGTGAGACCGCTTTCACCCAGCGATTGACAT
CAACAAATCGGACCTGGCGACGGCGAGGACACCTGCGACGCGTTGCTCGAAGACGAAGCCGCCGTTCTTGATTATGCGAGCTGTTTCATCTGGATCCTCC
GCCTTGTGATCCTTCGACAAGCGAACAGCTTTGCCGTTGCGGCAGATCACAGAGCGACTGCTCACAGTCGTACCCCGTCATCATGAATCGAGAGAGTTCG
CTGGTGAGATCTTCGCACAGTCACGCACCTATCGCCGGCGTTGGACGAGTACAGCACTTTCTGATCGCCTTCATGGAGCAACGTCGCCGTGACAGCCGTC
GAGCCAGCAGAACTTGAACATGTTTGGCAGCACTCGAGGTCTGTGATCAGGTAGGCACTGAAAGGGAATCAGTGGCACAAGCTCCAGTGTAGTCATCGTG
GTTTGCTCCGCACCCCACCTTTCAATGCGCTGCTCGATCGTGCGGCCATCATCCATCGCCAGCTCACAAGCAATGTTCTCGTGCAAGTGCTTCTGAAGGT
ACAGCGACACATCGCGACCTACACTCCACCAAAACCTCTGAGCGAAATCGCCGTCTAATGAAATTCCTCGACGCCGCACCCCATCGCACCTCCATGGCCA
TCATACACGGCGAAAAAGCCGTTCTCTTTGCGTCCCAAAAAGCCGTCGACGATGCGCACGGTGTCTTCCATCGTCTTCCGCCGCTCCGGGTTCTACAGAG
AGCACTAACGATGTCAACGCTAACAGCAACGAGTTCAGCAACCGCTTTCGTGCGCACCATTTCTTCATAATAGCTCACACAGCGGCAGCAGTTGAAGCTC
TGCGCGTCATCTCCTTCCATCGACATCACACTGAATAAGAAGAGACGCGAGTCGTCAGCTAGACAGAGAGAGAGAGAGAGAGAGCCGGACGACTCGTCCA
TTATGATCGGACCTTTTCGTGGACTTTCCCTCCAAGCTTTCGAATTGGAGAAAATATCAAATCGTACTTAACGGATTATACACAGTACACNNNNNNNNNN
TCCTCCAAGCTTTCGAACAGGAGAAAATATCAAATCGTACATAACGGATTATACACAGTACACTCATTCTGCTAAACCAGTAGATCCCCGTGAAAATAGA
GAATGTAATGAGAGACAAGAACTCGCTGGTGAACACAAGTTATTTGGATGGGATGCGGCTCAGAATGAGGCACGCCGACGGACATGGGATTGTGAGAAGA
CTTTTCAGAACGAAACTACCTCGAGAGCAGAGCACTCCATTTGAACTCCCCACAGCCAACATTGCCCAGCGACGGCCCGCACCAAAAGCAGCATCCGAGC
GACAGCCATGTGGTCAAAACCACTGTAGAAAGGAACTTCCCGCAGTAGCAGCGCAGGAGATCCGCACTTAGCGAATCTATCTGTAGCGGCGGAGCGAGAG
CGTGTTGCGACGCTTCCAGTTGCCACGGTGCGAGCCACCAATGATCTTGTTGGCGCGGTGGCCACGCTTGCGGAGACCACGGGCCTGGCGACCGGCCGAC
GTGAGGCCACGCAGCTCGCGGTGCTTGTGCACCGGGTTGACGATCCAGTTGATACGCGGGTCGCGACGGATGGCCTTGTGCGAGTAGTCGACAAGGATGA
CCTCGAAGTACTTGTACGTCGCGTCCTGGTTGACCCAGTACGAGTTGAGCACGCGCATGTTGGCAAACTTGCGGCCGACACGCTCCTCAGCGACCGAACG
CAGGTTGCGCTCCGACTTGAGCTGGTTGATACCCTGGTGCGAGGGCTTACCGTACACAATGCCCTTGGAGTTCTGGCGCTTGCGGCCGCCGCGACGCACG
GCGACACGCACGACAACGTAGCCCTGCTTGGCCTTGTAGCCGAGACGGCGGGCCTTGTCGAGACGCGTCGGCTGCGTCAGGCGGTGCACTACNNNNNNNN
NNNNNNNNNNNNNNNGACGGTACTCCCACGCGCGCACGCGGAGCAAGAAGCGGAGCGCATCCGACTGCTTACGCTTCCACAATTCCTCGAGATACTTGTA
GGCGCCCATGACTGTTG