Description :
From Genome Similarity Track
Location :
Scaffold_2939:524- 2000
Transcript NameFunction/comments
Phypl_g15505reverse transcriptase

Sequence
1476 bases(100 bases per row)
TGTCAAGTCTGGATCCGCGCTAATCTTCAGGTGTCCGTACAGCGCATGTCGATGAGCCACTGATAGATCTGAGGTGCGTTCTTCAATCCGAATGGCATAC
ACAGCCACTCGAAAAGCCCGAATGGGGTGATGAACGCTGAGATCAGCCGCGCTCGCTCGGTCATGGTGACCACCCAGAATCCACTCGCCATGTCAAGAGA
GCAGTACCAAAGCATcttgtccgagtcgtccagAAGATTGTTGATCAGCGGCATCGGATACGCCATCAAGCGCGTCAGGCCGTTGACGACTCTGTAATCA
ATGCAGAGTCGAATATCAacgccgttcttcttgacgatgaTCACGATCGGGGATGCCCACGGTGAGGTCGAGTGCTTGATGATCATAGCCGACAGCAGAC
CCTTGATGAGCGCAGCCAACTTCTCTCGAAATTGTGGAGCAACCGGTCGCACGCACTGGGCTACTGGAGTGGCACCAccgacgtcgatgtcgcacagtgc
accgcgtgctgcaggtggcagGGCGTTCCCTTTTCCGATCAGCAAgtgccgccttcgccagATGATCCGTCGCAGCCGATCGATCTCTTCCGAGGTATTC
AGATCGGGATCGCCAACCTGAATGTCTTCGATCATTACCCCTTCAGTCGAAGATGCTACCTCGGGCAAGATGACCAAGTTCCGTTCGAGATCTTCTGCGA
ACAAGCCGCCGCCCTCATGGTAGCAGACCTGTTCTGCCTTAGCTTCAGCCGAGCTCGATTCCAGTGAAGTATCGACTTCGGTCTTCGGCAGATCTTGTCT
TGACTTGGCGGACCCCTCTTTCTGGATCGGTGCAGGCTCCTGGGCGACTCGCTCTTCGTCCACCTCTTCACGCTTCACCTCGGCTTTCGGCAGACCTTCC
CGTGTTCCTTCGCAGGGCGATGGTAAGACTGTTGCTACGGCCACCACTGGTTTAGGAAGCCCATCCGACCGACTCAGAAttcgcgtcggcgtcggatATT
GAGGCCGATCCACCAGCGGTTCCACTGACTCTTCTTCGGGTCCGGGTTCCTCCTGTCGCTCGGTGGTAGCCTCGAACGCGAGGTTCTGTCACTCAGCGTA
TCTGGGCGATCCGACTGAAACAAAACCTGGCATACGAGGTACGGCGTCTGGGGCTAACCGAGTTCCTAGCCGTGCGTGCCGATCGAGCACTAACTTCTCT
TCGCTCACGTTTGTGATCCGCAGATACCTCGTTCTACCCAGACCCCTGATAGCGGTCGGCACCCATCTTGATCCCCGTGTGATCCAGAGCTTTGCGCTAG
CCGGTCTGCCGTATCTGTGGAGTAGCGGGATCAGCAGAATTCTTGTTAATGCTGGATCCGACTTCTCACtgcgcccagacaccgactaacggagggggtc
cCCCGATGatccgtgatcgtgctgaactggtcaccttgtgtacccgtcggtagGGCTGGATCTTGCTCTCTTGGTA