Description :
From Genome Similarity Track
Location :
Scaffold_3309:524- 1854
Transcript NameFunction/comments
Phypl_g15756reverse transcriptase

Sequence
1330 bases(100 bases per row)
atgtcgcacagtgcaccgcgtgctgcaggtggcagGGCGTTCCCTTTTCCGATCAGCAAgtgccgccttcgccagATGATCCGTCGCAGCCGGTCGATCT
CTTCCGGGGTATTCAGATCGGGATCGCCAACCTGAATGTCTTCGATCATTACCCCTTCAGTCGAAGATGCTACCTCGGGCAAGATGACCAAGTTCCGTTC
GAGATCTTCTGCGAACAAGCCGCCGCCCTCATGGTAGCAGACCTGTTCTGCCTTAGCTTCAGCCGAGCTCGATTCCAGTGAAGTATCGACTTCGGTCTTC
GGCAGATCTTGTCTTGACTTGGCGGACCCCTCTTTCTGGATCGGTGCAGGCTCCTGGGCGACTCGCTCTTCGTCCACCTCTTCACGCTTCACCTCGGCTT
TCGGCAGACCTTCCCGTGTTCCTTCGCAGGGCGATGGTAAGACTGTTGCTACGGCCACCACTGGTTTAGGAAGCCCATCCGACCGACTCAGAAttcgcgt
cggcgtcggatATTGAGGCCGATCCACCAGCGGTTCCACTGACTCTTCTTCGGGTCCGGGTTCCTCCTGTCGCTCGGTGGTAGCCTCGAACGCGAGGTTC
TGTCACTCAGCGTATCTGGGCGATCCGACTGAAACAAAACCTGGCATACGAGGTACGGCGTCTGGGGCTAACCGAGTTCCTAGCCGTGCGTGCCGATCGA
GCACTAACTTCTCTTCGCTCACGTTTGTGATCCGCAGATACCTCGTTCTACCCAGACCCCTGATAGCGGTCGGCACCCATCTTGATCCCCGTGTGATCCA
GAGCTTTGCGCTAGCCGGTCTGCCGTATCTGTGGAGTAGCGGGATCAGCAGAATTCTTGTTAATGCTGGATCCGACTTCTCACtgcgcccagacaccgac
taacggagggggtccCCCGATGatccgtgatcgtgctgaactggtcaccttgtgtacccgtcggtagGGCTGGATCTTGCTCTCTTGGTAACTGCGAGGT
AGTCCAAGTAGTGAAgtcttgaacgtcttggcgagACGCGGGGAtggggtggagcagcgcggaaaTCTTCACTCTGCGTCCTTGTTGTTGGTCCAGATCC
CAAGTGATGTATTCGAACTTGGATCTGGCGGCCTGGATCTGGATCCGGCCGTGTAGTTGCCTTGCGTGGGCTtcctttcttcttcttcctttcctggctt
gccgcttcctatagcgggatcttgagtTGTTGAGATACTGAGAGATCGTCCGGCCAAGCTGTGAACTCCGGTCGAACTTGGATCTGCACTTGAGGGTAGA
TCACTAGGTGGTTCAATCTGGCCAATCCGT