Description :
From Genome Similarity Track
Location :
Scaffold_1151:524- 1743
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1151-snap-gene-0.4HECT ubiquitin ligase

Sequence
1219 bases(100 bases per row)
ATCAATTAATCAACTTTTCAAAAGCAAACAAACGATACCATCTCACTAGTTGGTCGTGAAGCCGTAGACGTCTCTTTCGATCGCAGCATATAGGACGGCT
TGCAACTGCGCACGCGACACGTGAAGTGGCAGATCCAGGCGGTTGAAACACGCGTGGCTCCGGATGTGACCATCGCCCTCGAGCGGCACGCCTTTCAATG
TGAACAGACATAGACGACCATCGTAGCTCGTCAACGCGCTAAAGCCAGTCACGGGAACGCGCGATGCAGCTGTTGCAAACTGTAAAAGTCGGCGACGGTA
CTCGTTCGGCATCTCGCGCACGATCTCCCAGAACCAGGTCAGCACTTGGTGATCACGTAAATTTTCTGAGCACGTCGTGTACAGCATCCACTCATCCACG
TCGATTTCGTCTGAGCCACACAGCAGATAGTCGAGCTCTTCGGGGTCGAAGATCATGAGTAGTTCTTGGGGGACCACCTCGTACAAACCCTTGAGAAACA
CGTAGAGCTGACTGGAGACGCTCTCGAACAGCGTATAGCGGAACCTGCGCTCCAGGTACTCGTGCTTGTTGTCGTCCACGACGTCGATATGACGTCCGTT
CGGGATCAAGTCGACAATCCATCCTCCTTGTTCCGTGATGCTGAATGTGAGTCCCAAGGACTTGGCTCCTTGATTTTCTTCCAGCCAAAGCAGACTCTTG
TACACCCCGGGATCAAAGTACTTGAGATCCGAAAACGCCACGGGGAGTCCGAGAATGATCTTCAACAGAGGCAGCGACAGATGGAACCCCATCATGTTCC
CTTCAAGCAGTGCTCGGCCGATCAGCCGACCCACACCGTAGAAACACATGAGATGGTGCTCTCCAAGATCCTGCGCTGAGTTCTGGTTGAGATAAAAAGC
TGGCTCTTCCTTGTTCACACAGCGGAAGACGCAACCCGAGGTATCGATACGTGTATCCTTGCCAACGAGACACTGGTTCAGCAGCCCAAACCATTCGCGC
TGCAGTCCACCCGCATCGACTCCCGCTTCGTCACAAAAGTGAATCCGGATCGCTGCTGTCCGCATGTTGTCCGATGGGATCATGACCAAAGCCTCGATCG
AGTCTTGAAAAATGCGTTCGCGCTTGATGTCCAGTTTGATCACCTCCTTGTCTGAGGAAGAAGAGATCTCCAGGAGCTCGGCTGTAGCTTTTACAAAGTG
CGCATACTTGGTGGGGAAA