Description :
From Genome Similarity Track
Location :
Scaffold_1780:524- 1681
Sequence
1157 bases(100 bases per row)
AAGTTCAGCTTCACCTTCATCTTCAGCATAGCTGAGGTCCATCGGTTCCGGTCTATTACCGGCTGGAGTACTCGTGTAGTTTACTATCGCAGAACGAGAG
TTGTACCCATTCCAGCCAAGTCTGGCCGACTTGAAGTTATGCTCAGCATTAAGAGCAATTCTCACAGCCTCTTCGAATGTAGAGGGGTGAACCCGAAAGA
CTTCGGTTCTGGTAACGCCAGTACGGAGACCCTCCATGAATATAGTCACATGGACTGCTTCAGGCAGAGGGTCAGACTGCATAGCAGCCATGAGAATTCT
CAACTCTTGGACATAGTCCGTTAACTCATTCTTACCCTGACGGATTGATAAAAAGCGTGAACGCACGCGGTAAGCCTAGTTAGGTGGTGAAAACACCTGT
ACCAATTGTGACTTAAGCGACTCCCATGTGTGAAACCCTAAGTCGACCGACGTGATACACGTCAAGGCCCATTCTCTAGCTCTTCCATCGAGCTTTGAGA
TAGCCAGCGAGACCTGTTGATGGTCAAGCTTGATCAGGCCTGATCTCATGGCCATCTCAATCTCACGGATCCAGAGGATGAGGTTTTCACCCTCCTTTCC
TGAGTAGTTTTTAACTTCCACTCTAAGTGGACGAGGCCTAGCCTCTTCGTCTGGAACAGACACATAGCTTGTAGGCATAGCCACACCATTTGGTCTTGAA
CCTACCCTAGAAGGACGCTTCATACTGCAAGAAGCCCTCAACACGTGCAGTAAGCACCTCCGGGCCTTGCGATACAAGGAATTCCACATACTCTGGACCC
AAAGATGCGGTCAGCTTATCAAGCGCGACCTTTTGGGCCTCAGAGAAGGAGTGGGGTTTTCAATCCTCACGAGGATCAGTCTTTAAAGACTCAGGCGTAG
ATTGACTCGAGTGCTACCAAGTCTAGCGGAGCTGCACAGCTCCTTAAGTCAGGGGAATACTTAGTGCTCAAACATCGTTGTTAGTTTTAATGAACTAAAC
TTTATGAGCCAACAAGCGTAACACTTAGGGTCCCTGTTCCAGGGGACCGAACGATTCAGTGAATCTACAACACTTAGTGCTCAAGAGTAGCTATCTCAGA
GAGATGTTGCTAACTCTTAACGATCAACGATCCGAGACGCCTCGCAAGGCACGTGTT