Description :
From Genome Similarity Track
Location :
Scaffold_174:524- 1561
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_174-fgenesh-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
1037 bases(100 bases per row)
CTCGTTCCATTGGTGAGGAACCGAAGACTCTAAAGCAGCTTCACCAAGAAGCAGTGAAGGAGGaCAAaGGGCTGGTGATCTATGCTGGAGGCGATTTGGA
CTCTCAGCAGGATGGTTTGCGTTCTGCATGGAAGGCTGCCTACCCCGACaTCAACCTGACGATCGTCGTGGACTACTCCAAGTTCCATGACGTTCGCATC
AACAACCAGCTCGCGCGCAACCGCCTTcAGCCGGACATTGCGATGCTTCAGACGCTGCAGAACTTCCCACGTTGGGCCAAGAATGGTGATCTGCTGCAGT
ATAAGCCAaCCGGATTCTCCCAAATCTACGACGGATTCAAGGACCAAGAGGGCTTCTGGATGGCTCATTCGATGATCTCGTTCGGCACATTTTACGACGC
CACGCAGCTTGGAGATCTTCCGACGCCGAAGTCGCCTCTCGACTTTGCCAACCCCAAGTGGGCTGGAAAGCTCGCGTCGGCTTACCCAAATGACGATGAC
GCGACCCTCTtgTGTACTCGCAGTACGTTAAGAAGTATGGCTGGGACTGGCTTGACAAGCTGTCGAAGCAGGAGATCGAGTTCAACCGTGGCgCGCACAC
GCCGTTTGATGCTGTTCtGACAAGCCGTCGCCGTGTTGCGGGCCTGGGCATCGGTATCAACATCGGTGCCAACTCGACTTCTCGCGTGGCTCCACTAGCT
GGAAACGGCGTCCCATTTGTTTgcTGGGGCCAGCGACTCGCGATCTTTAAGAAGGCGAAGCACCCTGCCGCaGCCAAGCTCTTCATGAACTGGGTCGTCT
CGAAGAACGTACAGAGCACCGCCATGGCTGGTTTCTCGGTTCGTACGGACGTCACGCCTCcGCTTGGCGGCGACAACTACACTTGGAACATCAAGGAGGC
CAACGTGGATGAaTTCCCTGCTTTCATGGCTGATCGTGCCGAGGTGGAGCGCTGGCGCCAGACGTTTTCGCTGTACTTTGGTGAGGTCCAGGGAAAGCCA
AGCCcAGGCTGGTTCGgCCCTCTTCCAGGTCAGTAAG