Description :
From Genome Similarity Track
Location :
Scaffold_180:524- 10608
Transcript NameFunction/comments
Phyag_g3146hypothetical protein PHYSODRAFT_560962
Phyag_g3147hypothetical protein PHYSODRAFT_354729
Phyag_g3148pleiotropic drug resistance protein ABC superfamily
Phyag_g314930S ribosomal protein S16, putative
Phyag_g3150hypothetical protein PHYSODRAFT_351449

Sequence
10084 bases(100 bases per row)
GCCTTCATGCAGCTACGCGCCAGAAAATCTGTGCTTCTCGATATGCCGCAAATACACCCGCGACAATCGGAATCTCTTAGTCACTTGTCGTGTGCTTCAT
CGCTCACGCGCTGTACCTTCCTCGGGAGATCACAGGTTTCGGAGCTTTTGCGTTTGCTCGCTCTTGGCCTGTTAACCGTGTCCTGTAAGCCTCTCTCCGA
GGCACACCTTGAGATTCAATCGCTGTTGGCCAGCTCTGTCCTTCGGAGGTTCTCTCGAACTCGCCCAGCATCCGTATCAATGTCGCTCGACTCATCCATA
CCTGACGCCTCGTTAAGTGAATCAGGGATAATCTCAGGTGGTTGGCCGCAAAAGTGAACACGTTTCGGTTCTCCCTGCTGTTCATCGGCCGGATCATCCA
GATACACGCTGAGGTCCGCTGTGCTGCCACTCTGATCCGATGAGCCAGAAGCATTCGAGTTTCCCGACTCGCCACGCGAGCGCTTCCTGACTGGTCCAAG
GCCTGTAAGTCCCAGCAGCTGAACGCCATCCGCGCTCCCTCTCCTGTCGCCGCACTCAGGAGCCATCATCAACGCATCTTGGTCCGGAACCTGaggctga
agatgaagtccaGGAACCTGGCCTACCGGAGCCATCGGGAACATCGGCGGCATGTTGCGTCGAGTAGGAGACAGCTCCAATCGGTGCGTAATCTGAGAAT
TCAGCAGCGTATTCTGCTGCAACTCCAATTCGTCTCGGGGGAGCCCTACACGGTTGCTGATCAGCTCTGCAATCTGCTCTCTTGAGTCGAAAGCCTgcaa
gtaaaaaaaaataaaacCACCACATCAACACACATATTCCTTGTAGAATTCACCCACAAAAACCAATTGCAATGCACCTTGAACGTGTACGACCTCGACG
AACCTCCGAATTTCAACACGGAGCCATGCACCACGAGCGTTGGCTGCAAAGCAGTCAACCTCAATCCGTCCACGAACGTTCCGTGAGCAGATCCAAGGTC
CACCAGGTACGTCGCGCCTTTCTCGTGATGCACAATGGTCGCATGAAGTCTCGAGATGGAGCAATGACTCAGCACAATATCGCACACTGCAGCATTGCGT
CCGATCAAGTAGAACGCCTTCTGATCCACCGTGTGCTACAGAAACCCATAACAACAATAAAATTAATACCGAAAACTCAAAGCTCTCCCAACTTTTCCTC
GAAATATCGTACCGTAGCAATGAGCACGTGGTCTTTATACACGTCCAGCAACGAGATCGTACGCGGAGACTTGTGCATACACCTAGTAAGAAGTTGATCA
ATCACCATTGGATAAAACAATAAGTTTCAGTAAAATAAAGCCACAAAGAGACATAAGGAGGTGGGTGTGGGGAGGGGGGGAGAATAAAAGAATGCTTTAC
CATGTCGGTGGGGGGAATGGGACAGTGGGGGGGTCGATAGGGTCGAGGAATTTGGGCTGCGAGACGAACGTGTCGAGATGGAGTCTCGGCAGCTGGAGAG
CCTGCTCCATTGTTGAGATCGTTGCTGGGGCTGTAGCTGCGGGGGCGAAAGTTGCAGTGGCTGGCGAATGCGAACGAAAGCGTGCGCTTTGACTTTGTCT
TGTTGTGGTGGGTGTCTGCAATTGCGAGGAGGGGAAACGGAAAGCCCCAACGCCTGACGACACGACGCTGGAATTCCtgtatctgctgcagtggcgatTG
ACTGAGTCGAGTCCAAAGTCTCACTAACAAGCGGACGAACGCTTTGGGACTATCGATACACTCACCTCTTGGGGCTCCGTGGTCTTGCTCTGCTGTGTCC
GGGACTCGCTGAAGGTGGAGGGCGCGGCTCGTCTCTGCCCAGGCAGAGAGGGCCACGATGTGACGCAATTGGTCCGAACCGATGATCGAGCCAGACCAGC
GACAGCATGCAATGTGACAGGTCCACGTGCGATACACAACGGTATTTACAAGCCGGAACCAACGCATGACGGACAATAGGTTGCGAGTTTCAACCAATGA
GAGAGATTATTATGCGCCACGTCGGACTATTGGTGGAAAAGACAGCGGGGTCACCTTACTATCTCTCAGCAAGCAGACGCCGCGACTTGGACCCGACCGA
GAGGATGGAAGAGTACGTAGCGTTGCGCTATCGTCGCGGCGTCGTTGTCTTATTGGCCTACATACATACACTGACTACGTATTGTATTGCTTTGTCGTGC
TTGAAGGACGCACGCAGACCGCCAGCGGCAGGACGAACAGGTGAAGGCTCGGATTAGCGAGCGGCTGGTGCAGAGCGGTGAGAAGGAGCGACTGAAGGAG
CTACTGAGGCTCAAACTGGTGGAATGCGGCTGGAGAGATGAAATGAAGCTGCACTGCAAAGGTTAGAGCGCTGTAACGGCGCTGAATTAGGGCAAGTTAC
TAACTGGTAAGAACTGGTGACGCAACTGTAGAGGTGATCCGGAATAAGGGCATTGACCAAGTGACTGTGGAGGATCTGATCGAGGAGATCACACCCAAAG
GAAGAGGTGCAGAGCTTTGGCTTTATGCTGCTtgtttatttttttttttagtTATTTATTGTTTTCTTGTGGTGGATGTAATTGTAGCGTCGGTGCCGGA
GGACGTGAAGAATGatttgttggagaagattAAGGCGTTTATTGAGAAAGAGGCAGATTTcaagacgacggtgacggtGGCCAGGGACGACAAGTAGCTG
AAGCAGAATTTGAAGCCATAGAGCAGACACGAACTAAATTCCCAGACGTGCGCTTCCGCTGATGGCTGCGGAAGCGAGTGAACGTTGTAATAATACAGCA
GGCAGGAAAATCCAGCAGGCAACCAACGACAAGGAGATCCATTGACAGTTTTACCACATGGGAACAACAGTGTATGGCTCTCGAGCTCCACAAGCTTTCT
TTCGCGACGACACTAGACCAGTCACTAAAGCGCGGCGTTCTATTGACTGACACGGCAGCGGCAAACCAACAGCTCAAAGCACCAATTGCCTCTTTTCAAA
AAAGGCAATTGAGCAGTACTACAGCATGGCAATGCTGTCACTTGAAGCGATAGCGGATATCTACAAGTAATCCCGAAGAAGTTTTGGGCGCAGCTCGACG
TCAAAAGCGGAAAAAAAAGAGTGAATTGTGTATTGTTTCTCAAATGATGAAGTGCAGATTTGTTGAGACTTCTATCTGCtcaacttgagcagctcaagtg
TCTACCGCTTTtggtggttgatgaagcgcaTTGCTAGCAGTTTTAAGACGCCATAGATGACTGTGATGCCGACAATGACCGCGAAGTTGCGAGCAATTCG
GTCGTGCTTCATGCCGAAGTGGTCCTCCGTGTACTCCTTCAGCGTGGTGTGACCCACCGTCACGGGCGCGTTTTCCATCGGTCGGCAGCCAAGCTGTGAA
CCCACGTTGGTGTAGGCACCGAGAGTGTCATCCCACTGAGGAAGGTGGTCGCAGTCGGCGAATACCAAAGCAACCATGGTCGCCAAAGGGTACTTGATGG
GGGAAATCTTGTACAGCCACGTGTAGCCTGACGGGATCGCGTTTGCCGGCGGAGTGAAGCCCATGAACATCATGAAGATGGCGTTGATCAGGTACCCCGC
GACGATCGCGACTTCTTCCGTTGGGAACACGAACGCGAGCATCTGACCTTGGTAGACCTGCATCAGTGTCATCATTGAGTACGCCAACCAGTACACCACA
GCCGTGTCGAAGCCCTGAAAGCCAACAAGCGGGTAGAACACGGCTGTAAAGATCAAGCCGCTGACGAAGGTATAGGGGATCTCCGAAATCGTTGATCCCA
CGAAATACCAGAAAGCGTTGTACGTCTGCGAGGCGCGCTCGCGGTAGAACGAGGGTCGATCCGCGAATACAACCGGTAGCACGCTCTCGAACGACACGAA
TGCGTTGAACAGCGAAGCCATGTAGATCAAGCCAACGCCCGAGTTCAAACCCGAGTAGGTCGTGTACGTCGCATCGACGAAAACCAGTCCAAAAACCACA
CCCAGGAACAGCGAGATCAAGATCCGTGTCAAGTTGTACGATGGTGTGCGCCAGTAGGCCTGAATGAAGCGAGTCACGACGAACTTCATCTGAGTGACAG
AATTGGCGGCACGCTTCTTGCCGAAGACCATTTCCGGGAGATCGGGCGATGGGATGGAGATGCCTTCCTTGGCCACACTCGCGtccagttgctgcttttg
tGAACTCGAGTTGAAGACCTCAACAAAGTCCGTGGTGATCGCTCCATTGCTCACACCAGCGCCGATACACTCGAGCATCCAGGTAGCTGGGTTGTAATTT
TCTGGAAGTGGGGATACGCCAGGGATGGCCTCGAAGTAGCCGATCAAGTTATTGCAGTTCTCGCCCAAATCGCCGAAAAAGACCGTCTCGCCACCGCGCt
tgagcaacaacaagctgtCAAACAAGTTGAAAACATCCGACGAGGGCTGATGGATCGTGCAGATAATAGTACGCCCCGAGTCAGCCACTTTCCGAACGCC
TGTCATGATCAACTTCGCAGAACGCGCGTCCAAGCCACTCGTCGGTTCATCGAGGAAAATCACGCTGGGTTGTGCTGCAAGCTCCACGCCGATCGTCAGT
CGCTTCATTTGCTCCATCGAGCTGCCTCGGACGATCTGGTCGGCGATATCTTCCAGACCGAGAAGTTCAATGCACTCGTTCACCGAGTCGTATTTCTGCG
CATCGGAGATCGAGGCGTCTTGGCGCAAGAAAGAGCTGAACGTGAGAGCCTCGCGGAAGGTAGCTGCTTCGGAATGGACGTCCATTTGCTCACAGTAGCC
GGTGGATCGACGGATGGCCAGGTCGCTGGCCTCGTAGCCATTCAAGAGAATCTTGCCCGAGATCTTGCCTCCCGTTTTACGGCCAGCGATCACGTCCATC
AGCGTGGTTTTACCTGCTCCTGAAGAACCCATCAGAGCCGTAATTGAGCCCGGAAGCGCAAAGCCAGTGATCCCTTTCAACAAGTCGAGCGATTCCTTCT
GGTTGTGAGGGTCCGGAACGGAATACCACAAGTCCTGGAAGGCTACTGTTACAGGATCGACAGCGAGTCTCTCGCGGCTATCGATCTCGACGGCACAGTT
GGCAGTGTTCACTGAACAGTTCTTTGGAGTCTCAATCAGCGTATaagcttcgtcttcgaccGAAGTCTCCGACACATCGACGTTCTCGGGCGCTTCGTAG
CGGATGTATTCCAGTCCAATATACGAGAAGAACATGAAGACGAAGTAGATGGCGAACGTGTACAGGATGCCGTACACAATCCATAccttgtccgtcttca
tgGAAAAGAGCTGCAGACTGTACTCGCCCATCGTGACGCCATACGTTGCGCAGTAGTCAATGCCTTTGTAAACGCAGACGTCAAATGTGTTGGACCGGTA
CTGGTTGATGGCGAGAGCGCGGAGACTCCAGCTCATCGGGCTGATGTAATGACcccagatgaagaagtcggGGATGTTGTTCTTGGTGACAATAAAGCCC
GCGAAAAGGATAAAAATCAGGAGTGACACGATGCCCAGTGGTGCTGCCACGTTGGCGTTGGGACTGATTGCTGCCAGGAAGGAGAACCACATGCCCATGG
CCAGATTCGTCAAGAAGagaatgatctcgaagatgatgaagcacgctgcgtctgcttcaAAACCACAAATCCAATATACCATGGCGCCGAAGATGATCGA
CTCGGCGAGGATCAGCGGGATCTGGCTGGCTGACGTCGCCAGAACGTACGCTTTGGTACTGAAGAAATTCGCAGcgcgctgcttgtagaagatATCACGC
TCTGAAATGTACGTTGGCACTTGCGAGCTCTGGCCCATGGAAAGGAAAAGAATGGTAGCGAAGAGCACGCCCATGACAACGGAGACTTCAGTCGGATCGA
AGTCGGAGAAAACAGTGGAGTACAGAAGCCCCATGATCAAGATCATCAACACCCGCCCGATAATGAAGGGTTTGTTCCGATACAACACCATCATCTGACG
TCGTACCAGCGTCTGCATACCCTGCACGAACGATTGCTGGAACACAGGCACTTTCTCCAGTCGTTCCTGGACAGCCTTGAGGTCATTCGGATCAGGTAAA
GCTGCCAATAGATCGAGTGTTTTCTGGTGAATTTGTGACTGTCGGAAGTGCTCTGCGAAGTCGCTCGCGAGTCGTGGGTGGTTTCTCTGGTAGTTGTCAA
CCTGGTAGCGGTACTGTTGGGATGTCCCCAGGTCCAACAGAAAATCGGCCAGATCGCGCTCAGGCGGACACGAAAATCCTAGACCTTCGAAGTATCCCTG
CACTTGGTCGCAGGGGCCATGATACATCACTTCTCCTTCGTTCAGAAtcatcacgtcgtcgaacagcgcGAAGACCTCAGGTGAAGGCTGGAGAAGAGCG
ATGACAATTGTCTTGCGAAGCTTCCTCgcgacgctgcgctgcgtgTTGATGATGTCAAACGTTGCGGCACTATCGAGCCCGGtactgatctcgtccatga
gcgCCACACTCTTCATCCCAAACTCCATCTCCGCAGTGGTCACGCGCTTACGTTCACCACCAGAAACACCGCGTGTCATGGCATCGCCCACTATCGTGTC
CTTACAGTTCTGCAGTCCGAACTGCTGGACGGTAACATCGGGATAGTGCGTGTTAATGGCTCGGACTGCCTCAAGCGCTTCCCTGTTCAACTGGTTATCC
TCGGCTTCGCGTAAGAACTCGGCTCCTCCGACTTCGTGCGCAAATTTCAAGGTCTCCGTCACCGTCAGCAGAGGGTAATGCTTGTCGCGCTGATTGACGT
ACGAGACGACCTGGGGTAGCCGGTTGAGCAGCGTTTCCCTCTTTATCCCATTGAACGAGATGTCGCCATTGACAGTGATGTTTTTCTTCATGGGGAACCG
ACCACTAAGGATCTTCAGGAGAGACGACTTGCCCGATCCAGGCTGACCCAGCAGTAGCGTGATCTTCCCTGGCGCGAATGCACCCGTGACGTTTTTCAAG
ATCTCCTTCCGCACAGTATGTTTCTTGGACACGGTGAACATCTTCTTTGTCTCGTTCAGCATCGTCGGTAGCTCATTCTTGGCCTCGTTCTTGTCCGCGA
CGGAAATGTCCGCGGAAATCGACAGATTGGTGAAGTGGACGTTCACCTCCGGTAGAGTTCGACCCGTAgctgcctccatcttcgtTGCGATCAAGTCGTG
CAGAGCTTCAGGACCTTCGGCCATCAATGCAGCGCCGGACTCGTAGCTCAACCGCTTGGTCGCGGGGTGCTCGGTGTGATCTCCCATATAATCGAATGCT
GGTGTTGCTTATGAAGGTTGGTTGGTGGCCTCGGCTGAAAGTTTGGGAATGAGATCGGATGAAGTGAAAGAGTGCTTCAATACATTCTAGTAGTATGTAG
TACAAGAAAGCATGTGACGGATCGGTCTCGTGCATACGAGTCGGGCCGTACCATCAACAGCGATTGTTCACACTGTCGGAATGATGTCCTCATCCACTTG
TGCGGTACTAAAAACCGGTTTAGTGCTTATGGCACGCGCTGCCTGCCATCATCGAAAGAGATGACGAGTCGCTGGCACATGCTAAATCAAAGCGTCCACG
TCCTGAGCCTCTTCGGAGACACTTTCACGCAAGCCCGTGGTTCCATGTGCGTAGCGAAAAAACTCGCAAGTCACTAAAGCGCAATACCGACACCATGTAC
GGTACACCACTTTAAACTTAAcgtccaccacaccacaTCTTTTTCCGGTATTGTGCGGCTGCCACTCACTCGCGACAAGCTCCAGAGCTCGGACGAACAT
GGTGGTGAGACTGCGCCTGGCACGCTGGGGCCGCAAGGACCTCCCTTTCTACCGCATCGTGGCGGCGGACGCGCGCGCTCCTCGCGACGGCAAGCACCTC
GAGATCGTACGTGTCTCTTTCTTATTCTTCTATCTGCATTTCCAACTTCATTTCTAACACCATGttttttatttatttatttttttgctACTTACATTAG
CTTGGTACGTTCAACCCCATCGCCGCCTCTGACGGTGTCAAGGAGCTGCGTGTGAACAGCCAGCGCGTCCGCTACTGGATGTCGGTGGGTGCGCAGCCTT
CGGACCGCGTGGCGCACCTCCTGGGCCTGGCGAACGTGCTGCCCATGCCGCCCACTCGCCAAtacaccaagaagaacatcCCGAAGAAGGACCGCGAATA
AGAGAAAAGAACGCTAATAGAGGATGGAGCATTTGGACAGTAAAAAAAAGGCGTTTTCTATTAGAAAATGGGGCAGAGGTAGCAATGCAGCAATGTAGCC
TACTTCTTGGGGGTACGGGCCCGTGGAGCAGGGCCTCGGGCCGAACCTCCGCCCTTGAGCATGTGGCCGCCCTTGCGCACTTGTTGGTTGAACGTGGCGT
TCTGCTCCTCGAGCCAGCGGCggatctccttctgcttctcctccttggctGCGAGTCGAGACTCCTCCTCCCTCTGCTTCTCGCGGTGGATGAACTCGGC
GTCCCGACGCAATTCGCGTGCTGCGCCCTTGCGTGCACGTTTGACTTGgcgttgcagttgcttgAGCTGAGCAGTGTCCTTGGGCGCCGTCTTGTCCTTG
CGTACGGTGTAGTTCTCGTCGAACATGGGCGCGAACGTTGGGAGCGTGGTTGGTGCGAAACTCTGCAGGCGAAGCGGACGACGAGCGTCCCAGCATGACT
CGAGACGGGTGTGCAGCTTCGAGATGACGGCGTTGACTTCGGATAGACTCGAGTCTTCCAACTGCTTCACGAGAGCGTGGAGAAGCAAGTAAAGCGGGTA
GAACAACTCGTCGAACGATGGTAGTGACGCGTACTGAGCCGATGAAGCGTCGAGGAGAGCCAAGAGAGAACTCAACACTTGAGCACCactgcacgacgag
ctgccaGCTAGAGacagacgaggaagagcaggcatcttctcgtcgtcggagtTAGCAGAGACCCACTCCAGTAGATCACGACGCAGCCAGTGGATTGAAG
ACTTGttgtcatcgtcttccttgGATTCATCAGCACCCGAAGCCACGAAAGCACGGAGGATGCGAGTGAGGAACGTCATGACCTCAGGCATGAATCGTTG
CTTGGAGCGCGTCATGTCCAGCGACAGTGACGCGGCAAACAGAGCTTGGGTAGCCTCCTGTGGTGAGTTCACAGTGCCACGAGCCAAACTCTCTCCGAGC
AGAGTTTCCATGGGAGACACGACGTTGTGGCGCAAGTCTGATGTCGGGAAAATGGAGGTCAGCGCcttgaagagaagcagctctGGTAATGTGGGCCACG
CGGAGGTGGATGCACGCTTGTGCAACCGCTTAAAGAGCTGGGCAAGTAGCTCACGCACCACGATACCCGCAGTGTCACCCATCTGCTGAGCCAGTGTGTA
CATGCTCTTCGCCAACGAGTCCAGGTCGTGCTTGTGTCCCGCATAGCGCGCCGCAAAGATTAGGAACTGGCGCACCATCActgcgaagaagcgcttcatt
ttgttcttgttctccaCGCTCAGTCGCGGGTTGTAGTACGTCACAATACGCTCCAAGATGAGGCCACGCTTCTCGGGTGAGTTGCGCGCGTGCTCCTTGA
AGAGCGCTGCCAGCTCCTCAGGAGACTCTGGGCACTCAAACACGAACGgaagctcggcagcagcctcctcAGCATCGTGAATCCGTTTCTGCTTCTCGGT
CTCTTCGTCACtttcagcctcctcctcttcttcttctttctcctcctccttcttctctttcttctccttagcctcctcctcctcatccgaTTCCGCTTCG
GAGTCAGCCTCGGAGTCCTCCTCTTCGCTCTCCTCCCCCTGCTCCTCGTTCTCATCTCCATcctcggcatcttcgtcgacCTCTTCATCCTCACCACCAG
CGGCAAAACGTGCATCAACCGCGTAGCCGTCCGtcaggtcgtcgtccgtaGGCGGCATCATGATAAGCTGcggcgccttctccttctttttgCCCTTCTT
tcccttcttgcccttccGCTTtccatcatcgtcactgtcactgtcatcatcgtcagcGCCGTGCATACGCGCCACACGCTTCTT