Description :
From Genome Similarity Track
Location :
scaffold_55:52399- 55260
Transcript NameFunction/comments
Plaha_PHALS_10498e3 ubiquitin-protein ligase topors-like
Plaha_PHALS_10499aspartate carbamoyltransferase
Plaha_PHALS_10500metalloprotease family

Sequence
2861 bases(100 bases per row)
TGCTTGGTGATACGTGCTCCATCTGTCTGCAAACATTAGTGGATCCTGTAATGCTTACAACCTGCTATCATGTCTACTGTCTTGAGTGTCTCAGCACCTG
GGCACACAGTTTGGCACTACATGGTGTAGTACGGCCAACGTGTCCACTGTGTAAGAATCCGTTCGAGGACGTGTACGCTAATGTGCGAAGTGAAACAGAT
TTTGAgctccttcgcttccaaggACGACGCATACATAATCATGGAAGAGAAAAGAGGCAGAATAATTATGTTACTAGCCGGGAGAGACGCCGTTCACTTG
TCTACCGACGTCATATGCGACTTGCTCGAGTAGCTGGAAACCAGGTTGAAGATTTGCTCACTTTTCCAAAAATGCATAAAGTTCAAGGAGAGTACGAAGC
GTGGATTGAAACCGAGTTGAGAGCTTGTATTGGACGGGATATAGAACTGACGGTACTGTTGGCAATCATCCAATGCTGTTTAAATACAATTACGCAATGT
GGACCCGCGAAATGCTATGATGAGCTCCAGCAAGCTCTCACGCCGTTTTTATACGAAGATGCCGGTCTATTTGTGAGAGAATTGGCATTTTTTCTCGGCT
CGCGACTGAATGTAGATGCATATGACGCTGCTGTTGAGTATTGTTGTGAAAATGCAGCAGAGTGCGAGAATACACTGTGCGCTGGAAGCTAAGGGATTAT
ATTGTTAAGCGAATTTAAAGCATTATGAACTTAATGAATAGCGTCATATTGTACGCAATCTCTGTCCTGCTGCGACCAGATCATGCCTTACCCAACACAA
GAGCGAGCAACGCCATTCGTACGTACATGCCATTTTCCATTTGACGAAAGTAAGCGGCACGTGGATCCTTGTCGACTTCTTCGGCAATTTCACCAACACG
CGGCAGCGGATGCATTATAATCATTTCAGATTTGGCATCTTTGATCACATCAAGCGTGATACgaaagctgtctttgacagCAATATAGtcctcttcgtca
tcaaatCGTTCCTAGTACAAATTATATGAGCAGTGAAACTCAGTCAGGTATACACGTGATTCGTCAAACCTTTTGCACGCGCGTGACGTAGAGTACATCC
GTCTCGTGGATGACCGAATCAAGGTCAGTGGTTTCATTCTGCTTAATGCATTGGCTCTGCAGCTCGTCGTACACGTAGCGCGGCATTTTTAAACTTTCAG
GCGACACATAGTTAAACTTTGGTCCGTACATAGCTAGCAGCTTGGACAACGAGTGCACAGTACGACCATTtttaaggtcgccgaccatGGTGATGACCTT
GCCTTTAAGACTTTCTAGATCGCCAAATTCGCTATAAATTGTATACAAATCTAGCAAAGCTTGGGTCGGATGTTCACCCACACCGTCACCAGCATTAAGC
ACCGGTTTCTTTGTCGCTTCAGCGGCTATCAAAGCACTGCCCTTGACTGGATGTCGAAGCACAACGACGTCGGCATAGCACTCAAGACATCGAATAGTAT
CGTGCAATGTCTCGCCTTTTTGACTGCTAGATGAACTCTCATTAACGCATACTACACGACCGCCAAGCCGCAGCATTGCTGCTTGAAATGAGCTGCTCGT
ACGCGTGGACGGCTCCATAAACACATTCGCCAGAAGCTACAGCCATCAATTCGGTTTCAAATTGCTCAAAAATGCGATGCAATTACTGCACATACCTTTC
CATTAAGTAAATCATTTGCGCCTTGCGTCTTGACCATCGTTTTCATCTCATCGGCTACGCTCAGTACGCGcctatttttttaagaaacTGTTCGAGTGAA
AATGGTCAAGAAATAATGCACTGAAATCATACGCACTGCGCGCTATCTTTGCCAAATTGTACTACTGATAAAATGCTCTCGCCTTCCCAAGCACCTACTG
CTGTCTTGCCGTCTAACTTGTGCGCCATCGCCTCGAGCTTCTGTTTAAATGTACGTCACTGGTCGAAAAAGCCGTTATTAACGATAATAAAGCACATAGT
CGTTATGACTGATCATGACCAGCAGGATGATGGTGACAATGAGCCTAAGAAGGGAAAACAAGGATCAGGTAAACGCTTTAACGATCGCCAGCGTGTGGAA
ATCATTCAAATGGCAGAAAATAGCAAAATCTCCAAGCGACAGCTCGCTGATAAGTTTGGTGTAAGTGAAGCAGCCATTCGAAAGTTATTGCGAAAGAAGG
AGGATTTTCTACAACGATACTATGACACACCAGAAGATATTCGTGATCAGCGTCTGCGTGGAAAGAGTACACGTCTTGTTGCTCCTGATTTCGATAGTAG
CTCTTCGTTACATGCTGGTGTGACGACACCTACAAAAAGCTCTTCAGATGATGTTGAGACGAAGAACGCGTATTTAGTCGAGGATTCATGGAAAGAAGGA
TTGCATACTTTGCTGACGCAAGTCATGCCTTTCCTTAAGAAATTTGTACAGAGCTCGAGTTCAAGTAACCATGCAGTTAAAGAGGAAGTTGGTAATATGG
TTGGTGTTGACGAAGTAGATTGGATCGGCTTCTCACGCGTATTGTGCGATATTCGTCGTGGCTTCCACAGGTATCCAGAGACGGGATACCAAGAAGTTTG
TACTCAAGCATTTATCAAACGATTTTGTGAGCAAGCACTGCATATTCCAGGTAGCAATATTCGTGAGATGGCATCTACAGGTTTAATTGTAGATGTCTGT
CATGATAATGCTACTATCTGTACCTTGGAGAAGCTGAACTTGCCAGTAATAGCCTTTCGTGCAGACATGGACGCACTTCCAATTGAAGAGCTGAACGATC
ACTTGCCGTACTGCTCAACGCAAAAAGGTGGACGCAGAGAGCTTCGTAAGCGTAAAAAGCG