Description :
From Genome Similarity Track
Location :
Scaffold_407:5239- 6350
Transcript NameFunction/comments
Phyta_totarag8006hypothetical protein PHYSODRAFT_557588

Sequence
1111 bases(100 bases per row)
CGGAGGTGGCACGTGGACTCTGGCACGGCAATGGACGCAACCGTTTCTTTGACAAGTGTGTGCAAATTGTGGTGTTCGAGAACGGCAAGGCCGGACTACT
TGGCGAACACTCGATGCTCGATGGCATGCCCATGGCACGCTACACGGACTACCTACTGTCGCGTCTGCACCATGGACAAACGGACCTGGGCCCTCGTGGC
CAGACGACGTCGCAGTTAGAGCGCTCGCTGGATGCCCCAAAGCAGATCACGTTCCGCTTCACGGCTCAGACACTGCGCAACATCGCCAAAGCAGAAAAGG
TGTTTGATCAAACGGTGATCGACCACGAAGTATTTGTGCAGACCTTTTACGGGTACGGTGCTCGCTCTGTTAAGGGGTTTCGTTGCAGTCCGGATGCTTT
CGTACAACTCGCCATCCAGCTGGCCTACAAAAagctgttcaagaagaacgtTGCCACATACGAGGCTTCGCAGACCCGCCTCTTCCTGCATGGACGCACG
GAAACCACGCGTAGTTGCTCGGTGGCTAGTGCCAAGTTCACGGATGCGATGGAGGATGCGTCGGGCGCCGTCACCACtggagagaagaagaaattcCTGC
TTGCTGCGGCAAATGGGCACGTAGCGTACATGCGCAAGGCCGGCGCTGGGCGCGGCGTGGATCGCCACATTCTGGGCCTTAAGCTGCTGGTTCAGCCTGG
CGAGCGCGTGCCGTTCTTTGAGGATCCGGTGATGACCAGGGCCAGTCGATGGCTCATTTCCACAAGTCACCTGACCAACGAGCTGTTCGATGGCTGGGGC
TGGGGTGAGGTCGTACCCGAGGGTCTGGGCATCGCCTACAGCGTCAAGGACCAGTCGATCCAGTTCAACATCGCCTGCCGCCAGCACGGTAGCTGGGGAG
CCCGAATGGGCCACCTGCTCGAGGAAAGCCTCgtcgagatgcagcaactcTTTGCCAAATCCAAGGACGTTGGCGCCAAGCTGTAGGTGTGCAGTCAAAG
GAACAGGAAAAGAAAATCGCGTCAGGAAGAAACTAGGCGACTCAAGTTGAGTCGCCTAGTTTGAATCTCAATTGCACCACAACATAATGCACAGAAACAT
TGCCAAGTTCA