Description :
From Genome Similarity Track
Location :
Scaffold_1203:5238- 10331
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1203-snap-gene-0.4Cyst wall protein
Pytiw_DAOMBR242034maker-piw_contig_1203-fgenesh-gene-0.2Acyl-[acyl-carrier-protein]-UDP-N-acetylglucosamine O-acyltransferase

Sequence
5093 bases(100 bases per row)
TTGAAGTTGCGTCATGGCGAACGAAGAGAGTACAAGAGTCAACTCGTAATGGGCACTCGCTCTTCTCCTCGAGGCAGGTGAGAGATAATCTGTTTGTTAG
TGCTGTTATAATCTTGATACTGACTTGCTCGTGGTGGCTGAGCTGACTATTCTTGTCCCAAGCCAATGAAAATAGAGCTGTCCTCGGCCCTCTCGCCTTC
TTCCTGGCCAGCTCTCCATCAGATAGACGCGTGGGTCGCAGTCTCGACAGCCTCCGTCTCAAGCGCAAGCTAAGGTAGAGCTGATCGTTAGATCTCCAAC
CGCACAGAATAGCCTCATCAAGAAAACAACTCGAACCTTTGCTTGAAGCCGCTGTCGCCGTCGTTCAAGAGCTCGCTGCACACGCTCGCTGTGGTCATCA
CCAGTTGAGACAGCACCACTACCAGCAGCTTTCTCCTGAGCGAGCTCTCTCGTGAATGCGCCCGAGACCTGAGAACTGACAGTCGGGTTCGCACCAGCGA
CCACGAGATGCTGCGCAAGATCCTCGTCGGTTCGGTACGCACAGAGCAGCACGATCGGATGGTTCCCACCTAAAGATAAAGACGGCAGATCAGTTAAATA
TCTGAAGCTCAGCACCCAACAATGCTCGCTGGGACGCACCGTAGGAGCAAAGCGCAACGATGTGGGCTGCTGGCGACCAGCTGACGTCCGTGACCGGGTA
CTGGTGGAAGAACGGCTGTCCCCATATGCATGTGTGGAACCTCTGACCCTGGACGCTCGCAAACAGGAGCGGCACGCCGTTCTCCGACCCGCTGACGACG
AAGCGACCGTCGGGGCTGAACGAGCTCTTGCCCAGCAGCTTCTCGCACACGACGCCCGTGTAGCTCTTGTTGAGCAGCAGGTACGATCGCAGCTCGTACT
GAAGGATGCTGTTGGGCTGCGTGTGCATGAGAAGATGTTGCTTCCTTGGGTGTACTTGCAGACTTGTGATGCTCGCCTGGCCTGTGTGAATGGTCTTGAT
CAGCTCGTAGGCTAACGAATTCGCTGTTGATGCTGCTGAAGACTGAGACTTGGGCTTCCAGACTGTGAGGATCCCGCGAGCGTCGCCACAGAAGAGCCGT
CCGGACTTTGGTTCGATACAAACACTGTGAACTGCAGCGTCGCTGACGCGAAGTCGGCCAAGTTCTCGCCCATGGCCGTCTTGGTTTGAGTTGCTAGTAG
ACTGAGTATCCCAGAAGCGAACTAGACCGTCTGAAGCACCAGTCAAAGCAATCTCGCGATTTGACGGATGGAGAATGCCGCAGTACACGAAGCACGGCGA
GGGCGTGTGCTGCCAGTTGCATAGTGCAGTACCGCCAGCCATGCCGCTGGTTATCTGTGCGATGCTGATGTCCCACAGTCGAGCTGTGCCGTCCGACGAG
GCCGAGATGAGACGCTGGGAGCTCTTTGGATCCCACTCGAGTGAGTAGATCATCCCCCGGTGACCACGCCTCACGAAGACTAACTGGCTCGAGTTCACGT
GGTAGATATGCACGAGGAACTCACCTGAGTCTGGATTAATCGCAGCCGCGAGGAGCAGTCCGCAGGAGCTGAATGAGACGCACGAACAGCCTTTCTTTCC
CGTCGGTAAGCGCGAAAGCACGCGATGCGGCACAAGACACGGCTCACTGGGGCTGCGTCTGCAAACCACGAGTGGATCGAGCATGTCCATTTGTAGCGGG
TCCATTGTCCGATGTGGATCATTGTTGCTTGGACTGGCTGGTGGCGACGTCTGGAGCTCCTCGTTGTTGTCCACTTCAGGCGGACGACTCGCAGTGTCTC
CCTCGGTTTCACTGTTCTCTTGAGCCAAAGTCGCATCCGAGGCTGTGTGTAAGTCGCTGACGACAGCCACGGGCGGGATGATCGGCCGAATGTCCACATA
GAGCGTCGACGGCACCACAGCCCACCTTCGCTTTTGATACTGCAGAAAGACAGCAGGGATCGCATTCGGGCCACTATTAATTGTCGCCTGCCACTGCCAC
TGCGCCTTGGCCTGGTACTGGTCCATCCACGTGAGGATCTGGTACTCAAACAGCTGCAGCCGCATACAGCTCTCCGCCCGCACGCTGTCGCCGCCACCAG
TTTCTGAGGAGTCGTCCAGAGGCGAAAGTGTCTGAAGCATTACATTGCCTTTCTCGCTCACTGGACTGTAGAACGCCCATGCAATGCGTCGCTGCCGGCC
TTGAGACTGGAATCTGCTGGTGAATTCGCTCTGCTGCTCTAGACGCTCAAAGCGTATGCCATTAAGCTCTCTGGTCTTAATTTTCTTCTCTTCTTTAAAT
TCTTCAAAGAGCTCAAAGAGCAGCAGCGTCTGTGGAGACAAAAAGTCCACGAGCGTGATCGGGAACCGCAGCGACTGGTACCACTTGAATGCATCTACGT
ACAGCTCACAGTTTAGCTTTGCATTAGGCTACAGCCACGGCCCTAATAGACAGACAAACGTACTGGCGTAGCTGCACGCGTAGTTGATCTTGGCGCAGGA
CGTTGTGAGCGTCTGGTGGATCGTTCGGCCGGTGAAGCGGTCGACCAGGTGCACCGCTACTTGCGGCCGCGAGTAGACACCGAACGGCAGCTCGCCGGAT
CTCTCGACGAAGAGCTCGATCCAGCATTTCTTGGCGATTGGCGCCAGCGTCTGGACCTGGGATTGCATTTGTGACGAAAGAGAGGGAGCTGTGGAGGACT
GCATTGGAGTTCGCAGTGTTCCCATGGCCTGGATGAGACGCCCCGCTCCCCACGGAACACAGGCCCGCGTGTTGTTGTTTCCAAAGCACCCGCCGAATGA
CAAGTCCAGTCGTGGCCCCGAGATGCGGAGATGCTGGTGGTGATGAGCCTCGCTGCTGCTACTATTGCCGCCATCGCGCGGGGTGCTGGTCGCAGACATT
GGCTGATTGTCCACAGCCTCGTGGGTGTGAGGCTTGCTCTTTTTCTTCTTCGACAGCCCTCTGGTTTTCTCTGCGGGTGCGTCTGTGTCGGCGCGAACGA
GCAGCGGTGACTCCGACTCGGCATCAGGCGCTGCGTTCGCAACGCCAGCTGCGGGTTCTTCCAGGGACTTTTTGAGCAGCGACTTGAGCTCACTGGCGCT
GGCGGGAGGGTTCCGGCCACCACTGCTTGGTGCATCGAGGCTGGAAAGGCCATCGCCCTTTAATTTCGTCCGCTTGGACTTGGACGATGCCTTGGAGGGC
GAGCCACTGTCCTTGGCCATTGAGAAACTCTCGCTCGTTCAGAAGCTCAATTGAGTGGGCTGGATCGCACGTTGAAGAGTCGACGCGGCTTTTGACTCGA
TCCTGAAATACTGAACTGGTAAAGAATAAATTGGTTAGAAGATAGATAGATACTTGCGCTGTGAGACGAATGATATGAAGAAACTCTATTGATGAAATGG
CGGAGGGGAGTTTGAAAGCAGCTCAGGCTCTCGTATGCGAAGGTGGCAAGGCCGCTTGACACAGCGACGAGCGGAATCGCGAGGGCGAGTCCACCACAAA
GTCTACCTAGTAATCAAAAGAAAGTAAAGACCATATACAAGGTTAGAGAATTGATTCGCAGCTCTCGTCTTTAGTGAAATCGTGTCGTACCATTTCGTGG
ACCATCGGCTGCCTCTCGGAGGAAATTCCGTTCTCCAGCAGGAACGTTTTCACTTCTTCCGCACGCAGCACGATCGAGTCCCTCGGCGTGAGGCTGCATA
AAACAAATCAACAAAGAGTGAGTATGCGCGATCACCGTATAAATGAGTGGCTTGCGCCTTCTACAATAGCAACAATCCGATTAAGACTCACTTGAGCGCG
GGCGCAAAGCCCGTCTTGGAGCAGGACGATGTCACGCCGAAGAGGTATCGGTACACGCGCAGCATCAGCTTGATCTCGTTGCGAGCCACCTGTGCGTATA
CCATCCAGCATCAGTCCTCCAATTACTCTAATTGTACACTCACTTTAGGCACGCACCTTGGCTCGTCGAAGGCCAATCAAGTTGAGACCCGCAAGCTTGG
CGCGATTGCCGATAGCGAGGCCATAGGGCAGCACGTCGCCGTCGACCGCGCTCATGCCGCCGACCATAGCCAGGCGACCGACACTCACGTGCTGCTTGAG
GCCGACCTGGCCGCCGATGATCGCAAAGTCCCCGATTTGCACGTGGCCAGCCACGCACACGTTGTTTGAGAGCACGACGCGGTCGCCCAGTGTGCAATCA
TGGCCAATGTGGGCCCCGCAAAGCAACCAGCAGTCGTCCCCCACGCGCGTGGGCGCGTCCAGCGAGTAGGACGTGCTGCCGTGTACCGTCACGTGTTCGC
GGATGACGCAATTGCGGCCAATGACGAGCGATGACTGGCTGTTGGCTGAGTTCGAGGCCGACAACGCGCTGTCGTTGTAGCGCACGTGCTTCTTGTCCTG
CGGCTGGCCGCCGAGGCACGCGAACGGGTGTACGACCGTGTCGCTGCCAACCAGGGTGCGGCCCTCGACGACCACGTGCGCCTGCAAGAAGACGCCGTCG
TCCAGCTCCACGTCCGGACCGACGATGCTGTACGGACCAATGTGCACGTTGCGTCCGATCGATGCATTCGGGTGCACGACCGCCGTCGGGTGGATGAATG
GCGACGACGACGCGGTGGCGGTTGCTGTGGAGCTCTCCACAAAGCGGTGGCGACGGCCCAGCGCACTCTCCATCTGGTTTCCGCTCTGCATGGCAATACA
CATACAAGGTCCATAGTTAGACATGCTTGTGGTTGTGTAGAAGCTATCACGCATGGCTGCTGGTGGCGTCACATACCGTCACGTGCGAGACGTACGCTTC
CATGGGCTCCATGGACGCAGTGGACGCCGTTGACTGCAGCAATCAGCACAGACGCGAGTCAGTTACCACATCAGCACGTAGCAGGCCCATATACATATAT
ACACAGTGAGAGAGGGGGAGCGCGTACCGAGCAGCGCAGCCACGCAGCAGAGGACGCGCGCGCCGCGGCGCGTGGTCGCCAGCTCCACATCATCAGCCCA
ATCAACCAATTTGGTCTGCCAGTTTAGTTTTTCCAATAATACGTCGAATAAGTATATTTATCCAATCAGCGCAAAGCCAAATCTCTATTTTAG