Description :
From Genome Similarity Track
Location :
Scaffold_346:5237- 8963
Transcript NameFunction/comments

Sequence
3726 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNATTCAGTTGTACGTATCCAGTATGGTCAGGCTAACCCACAATCTACGGTTGTGTGGGCTGGACGTGGTGATCAATGG
GTAACGCAGATTATCTACGCTGCGAAATCCTGGCCTATTGCTGTGCGAGTGGTAAATGTTTCGACCAAAATACTCTGGATCGACGACAAGATGCCTTTAG
CCAGGATTGTGGAGTACGGGTCCTTTCCACAAGCCGGTCGATTTGTGCGGCCTGGATCTCCAGCGTATCGTGAGTGGCAAAGTCTCATTCAGGAAATTGT
TTCGTCGCGGGATGCCAAGATTCGTGCTAAACGTCTGGCCGAAATCCGGGAAGCGTTTGACTCGCCGTATCCCAACACCAACACTCCAAAGTACAAGTGG
CCAACAAAGTTGCTGACGCGACCGAAGGATGGTTCGAACAGAGTGCAGATGGTGAGGTTACACCCTGAGTCAGGCACGCGTCGAGTGCGTTTCACCCGGG
ACGCCGCTACCCAAACTGAAGACGATCCTGAAGAGGACATTGTTCTCATGCGCAGTGTTGGAGTGGAGGCCAGTGACCTTGTTGATGGTTCCAGTGACGG
CATTATGGAAGCCGTGCCCTGTGGTGAGATTGACCCAGAATGCACGACATCAGAAGTCGCAACGGATGATGAAAACTTGGATCACGGTTCAAAAGGTAGC
AACAACCTAGATGCTAGAGACTCCCTGGATTTGCCGGTGGCAGTCATGACTGGAACGCCTATGGACAAGCTCAAGAAGGAGTATGACCGCTGTATGCGAG
TTACTGTTGAAGAGCTTGACTTAGAGCCAGCAGTTTATATGCGCGAAGGCAGCGAAATCCTGTCTCAGTTACGCGACCAATTGGCCTTACTTCCTGACTT
GCAAGATCTGTCTCCAGAATGCAATATCGAGGAGGCAGATGTTGGTGATCCAGTGAAATCCACGCCTGAGATGGTCGACAAGTTGAGATGAATCCTGAAA
CAGCATCGTAAGATCTTCCTTGGTGACGGTAATGCTGCTCCTGCACCTGCTCGCGGAGTGGTCTGTGACTTGGACGTCGGCGATGCGAGACCTGTTGCTC
AGCGACCGAGATCCATCGCGCCTCACTTGATGCTCAAGGTGTACGAACTCTTGAAGAAACTCTTGGAAACCGGACTCATCGAGCATTCTGAATCGCAGTG
GGCATCACCGATTGTGATCGCTCTGAAGAAGAATGGGATTGACATCAGGATGTGCATCGACTATCCTGTGGTGAATGAGTTTATCAAGTTACTGCACTAC
CCTCTGCCACTCATTGACGACTTGCTGATTGGTTTTGAGTCGGCCATGTGGTTTATGAGTCTGGATATGGCAAGTGGATTCTGGGCTGTCCTAATGACCG
AGCGAGCCAAGCTGATCTCTGCGTTTGTGTGTCCGTTTGGACATTTCCAATGGATCCGGATGCCGTTCGGCCTAAAGAACACCCCACTCATTTATCAAGC
AGTCATCAACAACTGTCTGTGGGGATTCGTTCGCCTGGATTCTGAGGAAGAAGCAGAGGTGGACCCTGACGTACTTGATTTCCTGAAACTTGATCCTCTG
GAACCCAGGAGTCCTGATAGTACTGAGGAGGATTTCTCGATCTTGACGGATAAGATGACAGTCTTCCAGCGTAACATCCCAGCCCCACCTCAGATGGGCC
CTGTGCTCGGGCGCAGCTCGTACATTGACTACACCGCTCATGGTGCACCAACATGGGATCACCTGTGTGTAGACTTGAACGCTTTACTGTTTCGGTTACG
CTATTGGAATATCTCTGTAAGTCTACCCAAGAGCGAATTTGGCAAGTTGTCCATCCCGTACATCTCGCATGAAATTAGTGCTGAAGGTATCCGGGCGAAA
CCAAAGATTGCGAAGGGAGTCCAGGATTTGCCGTTCCCGAAGACACTCAAGGGAGTGCAGTCCTTCATGGGAAGTCTGAATTACTATAATAAGTTTATCG
AAGACCTCCCCGTGATCGCCGCCGTCCTATATGAGCTGACGAACGAACAGATACGCGCTGGACGAGACTTGTCGCGAGCCAAGGAAGCGTTTGAGATCCT
GAAGCGCAAGATTGTATCGACTCCACTACTGCGGCACCCTGACCGCACACGACCATTTGTGATCATCCCGCATGCTAATCAGTGGGCAGCGTCTGCGGTA
CTAGGCCAAGAGTACGACGGAGTCAT