Description :
From Genome Similarity Track
Location :
Scaffold_46:52367- 54774
Transcript NameFunction/comments
Hyaar_Emoy2806082reverse transcriptase

Sequence
2407 bases(100 bases per row)
AGAGACAGTTAATCTCTCGGAGCTGACGTGGGATTGGTTCCTGTCCAAACTAAAGAAAGGAAAGATCCACGAGATAGTCGCACCAGTTCCAAAAAAGAAC
TTGGTGGGCTGTTGTTCTTCGTCCACAATGGACGAGAGTGTCTTGTAGACCGACAAGACAAAACGATTCGCTGCTCAGGGCTGGGAAGCCTTGAAATGCA
GTCTGTTTTACGAAGTTCTGTGGTAGCACCGTGGTGTCTTTCCTACAGAAGTGCCGAACTGCCTACCAGCTGATAGGGGTATCCGGCACGAGATTGACTT
GGAACCTGACACCAACTATTGTGTGACGAGACAGTGGCCATCTCCGAAGGCACAGATCGACTACATCGACCAGTTCTTCGACAAGAGAGCCAAGGCGGGA
CATGTGCGTGAGAGCAAATCGCCTCACTGCAGCCCGACCTTTTGTGCGCGTAAGGCAACAGGTGGTTGGCACGTGGTTCAAGCTTACAATAAGTTGAACA
CGGCCACCATCCCATCGCAGACACCGATCCCGCGAAAGGTGTCATATTGAACTCAATGGGGAAGTCAACTGTCCTTTCCGCGTTGAGTTTGTAGGATGGA
TACTAGCAGGTACTCATGAATGAGACCGATGTAGCCAAGACGGCAACTAGCACCCCAAGAGGTGTGCTGTAGGAGTGGCTAGTGATGCCGCAAAGGTTGA
AAAACGCACCAGCGACATTCAACCGGTGGTCGCTCATGTGATGCGTCCACACCGTGCCTACACGCCTCATTACTTTGACGATGTATTCGTTCATAGTAGA
GCCGAGGACGGATTGAGTGAGATAGAATTGCACAACGTCATTTGGACGTTGTGTTGCAGACTCTGGTCGACGCCCAATTGTACGTCAACTTGCAAAAGTG
CGTCATAGGGGTCCCCTAAATACCTGTACTGGGCTGCATCGTGGGAAAACAAGGTATTAGAGAAGACCCAGAAAAGGCTAAAGCTAATCAGTGAAGCAAT
CACTTGTAGAGGCTTCGGTCTTGGTATTGCCAGACGCGGATAAGCACTTAAGTTTTGTCTGGAATGCTAGTAATTTTGCCATCGACAGTGCACTTATGTA
CAAGCATGACAACTACATTGACAGTGTTATCTCGCATTTTTAGTCCCGGCTTTTAAAGACCACGGAGCTAAATTATTTCGTGCATGACAAGGAGCTACGT
TATATACGGTAAGATCCTGTTAAGTTTCGTGTGCACCTTTTGGGCACCGAGCCTTTCGTAGTTTATACGAATCACGCATCACTGCGGACCGCATCGAATC
CACCGCACCTATCGCCTAGGACGGATAGAGGAATTAAATACTTCTCAATTTAATTTTCGAATCGAATGCAATCCGGGGAAGTCGAATGTCTTGGATGACG
CATTATCGCGCAGACCAGACTTAAGGAACGACATCACTAAGACGTGTCACGTGCTAATCGCATATGTAGTCGTCTACACTGGCAGTTCTACGGGTTGAAC
ATGTGACAAACAATACGGACTTTCATATGAAGGAGAGCTACATGCAAGACGAACATTTATGTCTGATTTTAGATCTCTTTGATGGACGAAAAGTTAATCT
TCAGTCGCACCTAAAGGCAAAGCTTAACCGATTTATCTATATTGATGGCCTATTATGGCATCAACTGCCACCTTGTGATACATTGAGAATATATGCCACC
CATGAAACAGATATCAAAAAGAAGATTATCTATGAGCTTCATGATGCACCATTAAGTGGTAATCAGGGCCGGTAGAATATATTCTTACGAGTGTCAAATA
ATTTTGGTTGCCACGCCTAAATCGGTGGGTAGCCAATTATATTCGATCGTGCGAAGAGTGTCAGCGCGTAAAAAGCCTGCATCTTCTAGCAGTGCACCAC
TAGATCCACAACCGATACCCACTTTTGTTGGAAGTCGGTCAGTTTGAAATTCATATTTGGATATAGCGCCTGACCATTAATACAGGACTGATCTTGTCGT
CTTTGTCGAAAGACTGAGCAAGATGGTGCATTTAGCACCATTTATCGTCAATATATAGCAGGAAAAAGGCAGACTTCTTGTTCTTCAATCACGTGTATAG
ACTAGATGGGGTACCCGAATCTATAGTTTTGGACCAGTATCCGCGTTGCACGTCAGGATTTTGGCGTCATGTGTTTGATATGCTTGATAGCAAGCTTCAC
ATGTCTACCTCTGATCATACCTAAACCGATTTCCAGACAGAACGGGCCAATCGTGTTGTGGCGGATGTATTGCGTACAATAGAGCCCTTTAAAGAATGGA
GCAAAGACTTTCCGTTCGTGGAGTATACTATAAACATTAGTGTTCACGCCAATACGGGGTGAAACACCGTTAATGTCAACGGAATGCGCCATCCCCGGAC
GCTATTC