Description :
From Genome Similarity Track
Location :
Scaffold_6:52362- 54588
Transcript NameFunction/comments
Phymu_g454hypothetical protein PHYSODRAFT_338448

Sequence
2226 bases(100 bases per row)
AAtctcaagaagcgcttccGAGCTCGGATGCCGTATACTTACACGGGCGATATCTGTTTGGCGGTGAATCCGTACCAATGGCTGGACGAACTCTATACGC
CCGGCCACCACAAGAACTACTTGCAAGCTCGAAAGCGACAGGATCTACCGCCTCATGTATACGCCGTATCGGTGGCTGCATTCAAGCATATGTGTGAGAA
CGCTAGCAACCAGAGTATCCTCGTTAGTGGGGAGTCTGGCGCAGGAAAGACGGAGACTACGAAAATTCTTATGGACAACCTGGCGACGATCGCACCGGCA
CCTGCCGCTGCTAGTGACCAGGAAAACACTATTACGACGCGTATTATCGAGGTGAATCCACTGCTAGAGAGCTTCGGCAACGCCAAAACCACGCGCAATG
ACAACTCCAGTCGCTTCGGCAAGttcacgcagctccagttcgaCAAGAACCACGCGCTCTGCGGCGCGCAGTGCGAGACTTATCTACTAGAGAAGACGCG
CGTGATCTCTCATGAACGTGGGGAGCGCAACTACCACATTTTCTATCAACTTCTGCACGGCACTACGGACGAAGAGCGGGACGCGTTGGGTCTTGGAAAC
GAAGCCCCGAAGTTTGCTTacttggaggagaaggagcccCAGGAGGAGGATCGACCAggacggaagaagaagctcagcCAGCCGCCACCACCCAAGTCTG
AGGCTGTTATTGACGCTGAGAACGCGAAAGACCGAGCGCTATTCGCCAAGACACGACAGGCGCTGTCACTCTTGGGCCTTGGctcggagcagcagaacga
tCTGTTCCAGGTCTTGTCCGGTATTCTTCACTTGGGCGAAGCTCAGTTCACGGTGAAGCCAGACAACGATGAAGCTTGCGACCTGGGCAAGGACTCGGTG
GTTTATTCCAGCACGTTGCTAGGCTTGAACCCGGATACAATGTCGAAAGCGCTTACGCATCGGACGATGAAGGCTGCTGGAGAGGTTTACCTGGTGCCGC
TGACTGTGGAGCAGGCGCAGTCTGGACGTGACGCCCTGGCTAAGGCCATCTacgccagcatcttcgactGGCTCGTGGCTGGTATCAACGCGAGTCTGGG
AGCTGCGCCACGGCTCACCAAGAACACTATCGGCGTGCTGGATatcttcggcttcgagagcttcgagCACAACtcgttcgagcagctctgTATCAACTAC
GCCAacgagaaactgcagcagaagttcacCCAGGACGTGTTCAAGGCCGTACAGGAGGAATATGAACGCGAGCAGATCACGTGGGCTCACATTGCGTACG
CGGACAACAGTGAGACCCTGGCGTTGATTGAAGGACGGATGGGCGTCTTGGCTCTActgaacgaggagatcgtgcgTCCTCGAGGCAACGAAGAAGGCTT
CGTTAGCAAGCTTTCGGGTGCTTACCTCaaacagaagaagctcattgaATTCCCACGTATCTCCAAGACGCAGTTCGCTATCCACCACTACGCTGGAACC
GTCAAGTACGAGGCCACTGGGTTCttggagaagcacaaggaCGCTCTGCTCTCGGACTTGTCGGATTTAATGTGTGGCAGCCACGAGCCGTTCCCCCAAA
TGCTCTTCAAGGTCAAGGCCGAGATGGAAGCTGCCTCTGCAGCTGAGTTAAAGCGCTCGTCTTCCGGCAGTCGTAAAATGGGCGGCGCTGGAGGGGATAA
AACCGTGGGGATGCAGTTCAAGCAGTCTCTCAACGCTCTCATGGCCAACATCAACGACACGAACGTGAATTACATTCGGTGTATCAAAcccaacagcgtc
aagagcGCCACACTCCTCGAGGACAAAATGGTCGCCAACCAACTGCGCTGTGCCGGTGTCATTGAGGCCATTTGCATCGCCCGCGCGGGTTACCCGAACC
GACTGCTTCATGCCGAGTTCGCTGAGCAGTTCGACATCTTtttgaaggagaaggagcagaaccagcttcaagaagaccCGGAGAAGTACGGCGCGCCGCA
CTGTCGTCTCTTGgtcaagcagttcaagctcgagatgcCCGAGGAGTATCAGATGGGCGTCACCAAGATCTACCTGCAGAAGGGtgtactggagaagctg
gagcacgccaaggcgcagaagctcttcgcctATGTGGCTCTCATCCAGGCCCAGTGGCGCGGTATGCGCGCACGCTGCCAGTACTACGAGATGCGTGACG
CCTTGGTCGAGATTCAGCGGCGCGTG