Description :
From Genome Similarity Track
Location :
Scaffold_387:5236- 9152
Sequence
3916 bases(100 bases per row)
GGATTGGAGAGGTGTAGCTTAAATAACGCTGCGCTGAGTTTGTTCATTGCCAATGCGTGGTACAAACATACCGACAAACTTCGCATGGTCATCCATGAAG
ATTCCGAACGTCCGCTGCGGGAACCGGACAGAGCTATCTCAAAACTGTGCTCCATTGCTGGGCACCAATGAATCGTGAAACCCTCGCCATATCGTTCCTC
GGGGCCAACCAAAGTGGAGTCGAAGACGACTAAAGTGGCATCAACCCACTCAAAGCCAGTGTTTGGAAAGCAAAATATTACTTTCAAAAGTGAGGGTACA
AACGCCGTGATTTCTCTAAAGCACGTTGTGACACGTGCAGAGAAATTGGTCACACCACTGGCTATCATGACAAGTACATTCTTCTTCAACGAGGAGGCAT
GGCTCAAACGGCTCGTGCATCAACTGCTGAAACACCCAGTGAAACACTGGAAGCAATCACTGGAGAAGAGGACGGGCCCAACGACGACGTATTTGAATCG
TATGACTGAAATTCGCGGGAGTCTTTGAGAGCCTGGACCGACATTTTCGATCCAGGAATTCTCACTGATGCCTCGATTATTGACTCCGGATCTACGAACC
ATGTGACCGGAACGCGAAGTCTCCTTCATGACCTTCAATAATGCGAGACTCATGCTGTCGAGATTGCTGATGGCGATCTCATTTGCGGACACCAAAAACG
AAAAAGGAGGTGAATAATATTAACGGAGCCGTATTCGACAACGTTGTCTAGCTTCCGGTCTGAAGCTAACATTAATTTAGGTGAAATAGCTCATTAACCA
TGGTACGAAAGTAGAATTTACTGACAAGGAGTGTTTGATTATGACCAACCGATCCTGCGAGACACCATGCGACGGGGGATACATGCTTTGGACATTCCTG
CGGCGTTGCTGCCTCGGCACTACGGTCATACTCTATCGAAGACTGGCATCAGGGATTGGACCATCTGAATTTCAACGCTGTTGCTGAACTAGCAAAGCCC
GACTGTCGTCAAAGGACTTATGACCGTCAGCCCCCTCACGCCCTCCAAGACGTGCGAAGTCTATGCCTTGAGCAAAATCATCTGAtcgcctgctgcgcgc
cgagcgTCTCGACCTCTGTCAGTCCAAAACGAAGTCTGTCGTGGTGATCTCGGCGGGCCATTCCAGAGGAACTACAATGGTAATCGCTTCTACTACGCAT
TGAAATGGAAAGGGCACACGGCTATTTACTTCATCAAGAAGAAAAGTGAGGCATCACGCTGCTTTTGAGACTACATGAACATTGTAAATCAGCGTTTTGA
CAAGCTGGGTGGGATCAAGGTCTACAGATCTCACAATGGTGGCGAATTTATCGCTGGTGACTTCCGCAAAGTATGTGGTGACGAAGGCATCACTGTGGAT
ATGTCGGAACCTGAAGTGTATCACCAGAACGGCGCTATAGAATGTACTCACCGTACAATTGCTGATGCAGCCCGCGCCACCTTGCTGCAAGATAAGTTTC
CTCATAACCTATGGGAGTACGCTGTGAGAAGCGCGTTGTACTCCAGGAACCGAGTACTCTCACGCATGGATAAGGATAATACCCCTTTTGAATTTTTTTT
GGGGGAGAGCCTGACATGAAGTTAATCACAGCGGTGCATGGTTCTCATACCATCTGAAAATAGATCAACACACCATCAGTTTCGTCCTAAGGGCTGGACG
GGCGTCTTCATCGGCAGTGACCCACGATGCAAGGGCTACTTCGTCTATGTAACTGAGCGCGGTCACCAAGTCATTCACAGCCGAAGTTTTGTGTGTTTTG
GAACCCCCAAGCATTCAGCCAGTCCCGGATATTATTTCGCCGCGAGACGACCCGCTCCGAATTGTCGGGGAAGATAACGGGTTAGAACGTGATCTATCTG
ATGACGAAAGTGAGGAGAGTGACCAGCAAAGTGGTATTGGGCCGTCTTCCAGTACTGTTGGAATGTGGTCGACGCCTATCAGTGTGACCCACACATAAAC
CTACGTAGAAGACATCAAATGATATTGAGTGAGTCTACGTGTTCCACATTTATTAATGTTGTAGAACataatgtagccatctctATTCGGTGGCCCTGCA
GAACACTTCATCTAGTGCCAACAACTTAATCTCTCAATCACTAGTGAATTTGCCTTCTCCAACTCaagtcttcttcttctcaaGACGTACCACCCCTTCT
CAAGTACGAATCAAGTTGCTGAATTTAATGACACTTTAGCTATGAGTCGTCATCGCCGGTCAGAACGCATTTCCAACCGAAATGTCAGTGTCTACACTTA
GTGCTGCTAATGTTACACTGCGCGAAGTCAGTAGTGAACCCGTCATCTTGAAAGAAGCCCGAGCTTCCAAAGAGTGGTTGCTCTGGGAAAGGCAATACAG
GAAGAATTTGCTGCTCTGCGTGCAAACGACACCTTCGAAGTTGTTGAACCATCTCCAGGGGATCATACCATTGGGTCAACCTTCCTGTTCCGCAACAAGC
TAAACGGAAGCGGAGAAGTGGATCGCCTAAAGGCCCGTACATATGGACAGGGCTTCACGCAAGAGTTCCTCAAATACTGCTTTGAAACGTACGCTCATGT
TGCAAAATTGAACTCAATTCGCATGTTCCTTGCAATGGTGACCAAAGTGGGCATGCGCGTACGCCAGGGCGATGTTTCCACGGCGTACGTCAATGCTGAG
CTAGCTGAAGTGATATACATGCTATAGCCCCGCCGATTTGAAGAAGGTAGCCGGACCAAAGTTTGGCGGCTCAAGCAGGCCTTACATGGGCTTAAGCAGG
TTGGCCAAGAGTGGAATTTGGAGATCATTGGATTTCTGGTGGTCCTCGGGTTCATTTCAACTCGCGATGACCCATGCGTGTATACCCACCCTACTAACAT
CTTAATTGTTTTGATCTATGTAGACGATATACTCATTGGTTACAAAGAAGAGCACGAAATGGAACAGTTGGTCCAGGCTCTTCGTGCCAAGTATGGTGTT
AAGAATCTCGGCGATATCAATTGGTTTCTTGGAATCCGCATTCACCTGAACTTCGCACAAGGAACTACGACTCTCGATCAGTTGCCATTTGCGGTGAAGA
TACTACGCTGGTTTGAAAAGGAAGATTGCCGACCCCGAAAGACCCCATGGCCAATGGCGTAATTTTGTATCGTCGGTCTCAGGATGGAGAGGCTGCTAGT
GATGTGCCATAACGACAAGCCGTAGGCGCACTGCTTTATCTTGCGCGGGTCACTTGACCCGATATCGCGTATGCTATAAATGAAATTGCAGCGCATGTGT
TAGACCCCTCAAAGGCGCATTGGGTAGCTGTCAAAAATATTATTAGATATATTGCTGGCACGATCGCGATGGGGCTAATTTATCGTCGCAATGTCGACGC
GGTTCCTGTGCGAGTCTACACCGATGCAGACTGAGCGAATATTGAGGAGGATCGAAAGTCGGTTTCTGGTGTTCTTGTTCAAGTATTTGGGTGTCCGGTG
TCTTGACAGAGTCGAAGACATCGTCTCGTGTCTAAATCGTCACCAATTGCAGAATATCTTGCTGATGATGACGGAGTGGAGGAAGCGATATAGACAAAAT
TACTTTGAGTCGTCTCATTACGTCTCAATTAAGATCTGCAATTCTGGCTATGATCAACAACAAGTCAACCATTAAAATGTTGACCAGCGGCAAAAATTCC
GAAGCCCAGAAGTCAATGGATTGCAGATTTGTTTCCATTCGCGAGGCAGTAAGGAGTGGTCTCCTACAGGGGAACTATCGCTCGACTAGATACATGCTAG
CTGATGGTCTGACCGAGGGTTTCGGAACAACTCGTTTTCGCGAAATACTTTCTACCATCGGTGTCGAGAAGTTCCCATCCAGCGCTGACGGGGAAGTGTT
GCAGTGCCAGCTTAGA