Description :
From Genome Similarity Track
Location :
Scaffold_1013:5235- 7202
Sequence
1967 bases(100 bases per row)
TACTTATAAATACATCAGTCTTAAATCTACTCCTCTAAGTAGCAAACCGTTCCCACTGAGACCGGGAGCACGTGGACTTACGTTCACTCGGGTAGTTAAT
ACCCTTAAGCACATCCTCTGTGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCTTACACCTTCGCGGGTAGATTGAGCTACCT
GAATCCTCTGTGCGCCCAACGTTTAATCCACGATGGACCGAAGTGAGTTTCCTCGCTTGAACGACTCACAGTACGAGTCTGCTCGGAAGATGGGAGACAT
CTTTGGACAAGATGTCCTTCGCAGCTTGGCGGCGGCGACGCCTGCCGAGCAGCAAGAGCGCGTGACCGCGTTTGAGACCTACGAGCGTGGTCTCATCGCT
CACGTCCGCGGGAGCTTGGAGGCCACGATGGCCGCTCCCCAGGCAACCAGGCCTAAGCCGGTGTGGCTGAAGGTCCCCGCGTTTGAGGGGAAGGGAGGAG
AGAACCTTCACTTCTGGGTCCGTGAGGTGGAGATCGCCATGAAGGCGGGTCTGATCTCGGACGAGCCAGTTCGGGTGGCGTTTGCCCTGTCCAACCTTGG
TGGACGTGCCAAGCACTGGGCGTACACTAGGGAGACGACATTTCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCGTTCCTA
CCGGCGAACAACGAGTTCCGCCAGCGCTCACGCTTTCTCGCGTGTAAGCAAGGTAAACGTGAGCTGCAGGAGTACGCGCAAGAGATGCGCACGTTGGTGG
CATCTCTGGCAGGGAATCCTCTGCCTGAAGACGTCAAGACAACAGTCTTCATGGACGGCCTGAAAGTCGGTCCTGCTCGCACCCAGCTATTCCGAGTGCA
AGCAACAACTATGGAGGAGGCGATTCGAATCGCCCTCCAAGAAGAGTACAGCCACAAGCAGGCTGGTACTCCTCGGGAAGAGGAACATCGCCACGATGAC
AATGGCGTTCCTCGGGAGGTGGAGCATCGAAGCAATGACGCTGTTGCTCCTGCTGTCACGCAGCCCGTTAATGCCGGTGCGTACAGCGAGCCCGAACCCA
TGGACTTAAGCTCAGCCGAGAGCTTGGTCCGCTGCTATGGATGCGGCGGACATGGACACTACCAGCGTATGTGTCCCTCGTCAGTCCTCGGGAAGAGAAC
AGCCCGTGGGCCCCAAGTCCGGTGGCGCAGGCCACGGCCAGGTGGACGAAGACTCCCCAGCCACCAGTAGAGGCGGTATGCCCTACTGAAGAGCGCTAAG
TCTTCGTGATGGGTGTGCAGGTTGTGCACACCACGGGATTTAGCCCAGAGAGACGTGGTTCTCTCAAACCGGTGAAGGGCAGTGCTGGGCTGCTGGTAGT
ACACTCAGTGTACGGGGGTACGATACCCCTTGAACGTTTGATGGGTTCTGGGGCGTTGATACGCGCCGGAACGTCGCTTGGCATAGCGACATCCGACTGC
ACTCTATGTCAGAGTGGCGGTCGTGGGCTGGTCCTTGGTGGACTAGCCTTTGGTACGGTAGTATCAATGGTCCCCAACGGACCTGAACGTTTCGGCTTGA
TGAGCTCGCGCACCGCGGTGTCGCTCGCAGTTCTCGCCATGAACAACATGGCTGTGCCGAACATAAGGCACAGCCCGGACTTTGGTGTGGCAAGGCTGAG
AAGGGCCTACCAGTCCAGGTCTATGACGGAGCATTGGTGAGTCATGTTCCCACCTCCGTCATGACTGGGGCGTCTGATACAGACCGCCAGGACGCAGAAG
CGTCACGGAGCTGTCAACGCGCCGACAGCTCTGCGTACAGCAAGACCATGCTCTGCTGCGGCAATGCCACGGGCGTGGGTCTTTTGCCCGGCGTGTGGAA
CTGCTACACCAGCATCGTCCAACGCCGAAGGTCGTCGCGCCGTACGGGCTTCGACTGTGGTTATGCC