Description :
From Genome Similarity Track
Location :
contig_5:523463- 534078
Transcript NameFunction/comments
g1601.t1hypothetical protein
g1602.t1hypothetical protein
g1603.t1hypothetical protein

Sequence
10615 bases(100 bases per row)
TGATCCATTCGTCTACAAAAATGGCATCCAGCCGATGTACATTTGGGCGAGGTTCTCGTGCGATGTGGCCTCGTGGATGAGCTTGTCCACTTGGCCTTGC
ACTGAAAGTGGGAGTGTCTCGTTTTCGGGCAGGATGCTGCGATGGGAGGACGACACGAGCGGGCGGATAGCGTCGCCCAGGTTGTAGATGCCACGCAGTC
GGTCGTCGATGGTCGTGAGCACAAGGCGCGTCTCTGCTTTGCTGCGCTCGCTCGAGATTTCGATACTTTTTTTGGTCGAGCCACTGCTGCTTTGAATCGC
CTTGCCACGGCGGCCCCACTCGACCAACGGATCGTGGATGAACGACTCGAGCACGCTTCGCAGCGTCTCGCTGTTTTCTCGAAGCAGATGTATCGTTACC
TCGCTGACCCGACGGAATACTCCTTCATAACCTGTGATTCCGAAAGCGTCAATAATGTTGGGCGTCAGACGGAATGGAACGATCTCGGGCTTTGCTAACT
TGAGTCCCTTATCGAAAAGGCAGTCGAAATCCACGTGCACGCACTCGCCAGTGGTGCAGTCGATCAAAATGTTTTCACCGTGACGGTCACCTAGACCGAC
AATGTGCCCCACCATAGACCACACGGCTGCCGACCGCGAGAATGCGAGCCGAGCCTCAAACCAGGCCGTCGGGTCGGCGAAATTATTATAAAACCACTGG
TGAAACCTCGGAGTGAACATTGGGTGCGAAAGCACCTCGCGGCGGTAGTACCGCGCCATCGCTGACGGATCTTGCGCGTACTTCTTTTGCATGTCGAGAA
ATTTCTCTTTGATATGTGTCAACCGAACAGGCTGTATGTAGCCACGCTCGGTTTTGTGGATCTGACCGATAAGCTGCCGCATAGCCTTTGTATTCCGTAC
CCACTCCATCAATCCGCTCTCCTCGTTTAGACACACCACCGCGTACGTGCGCAATCGGAGCTTGCGCTTCCGGCCTTCTCGATCTTTCTGAAGAAGTTTG
TTGATCATCGAGTTGAACTCCATCATGCGTGCATCCTTCCGAAGATCACCAGTCTTCTCGCGCTTACACAGAAACGGATACATTTGGCCATCGGTGCCCA
ATACTTCGATGCGTTTGGGCTTTTCCTTCGTCATCATCACATCAGCTTTATCACTAAATGCCTTGATGTAAACTTGAGCGTTCGATGAGAAGGCGACATG
GAGTTCATCACGAGGGGCAAGCCCCGATGCCGGCAGGATCGTAGTCAATGCCGCCTGGATTGGTACGAGAATTTTGGTTCGAATCCGGCTCAGTCGAATG
TGGATCTTGCGCTGATTATTACCGGGGTCGTGGCCAGCGAGACTAATAAGTTCTTCAGCCATTCGCATTCCCTCCGAGAAGCTGTCTGCAATCTCCTTAA
GACCGTTCGAAATTAACTGCTGCTGTGTGCTGGAGATGATTTCACGTGCACGACTTTTTCGCTGGCTATTCAATGATCGCGAGAGACCCAGTAGTGGCCA
CATAGCCTGTGTAGGGTAAGCCAGGAGCACCCGAATCATGATTTTCTTGACGCCGTCCACGACAACTGGGTTGGGGTGGCAAATGCGAGATATCACCTGT
GGGAAGCACACAAACCACTCATACGCCGGCAATGACTCGGTGGCTTCATCTACCACCTTGCCGATATCAGCCAGAATGTTCTGTTCAGGGCTGGGCTGGC
TCAGATGGTTCTCAATTTGCTGCATGGTCTTGTTTACTTTGTTGCTTGTTCGCCCACTGGAAGAACTGGCGTAAAGTACCTCGCCATACTCGAACCATAG
CGTCAGCAGTCGGGGAAGTGACTGGAATACAAACTTTGTTCCGTGTGTCAGCGCTTGCACATAGTTTTTCATCAAATTAATCAGGTGCGCATGAAATACC
GAATCTAGTGCAAGATCGGCAGCCTCGTCAGTGCTCACAGACCCACTTAAAGCATCGGGGTGGCGTACACTCAGCAAGTACTCGTAGTATTTAGCCAGAA
AAAAGTAACCTTTCTCCCACGTGGGATCGAAGTGAATGACAGCTTGATACCGCTCGATCACCTTTTTGCCTTGACGCTGGCCAGACTCTTGCATCCAGTT
GGTCGCCAACAGTAGGTTCTTCGCGCTTAAATGAGGGTCTTCAACGTCAAAGTCCAACGTAGATGCATCAATATCAACTGGCTCGAGAATTTGCAAAGCC
TCGTACATTCGGTCCTGGCTCACCAGCAGCTTGGCTTTTTCAATCAGTGCGTACTGGTTGTCCACTGCTTCAGCATGCATCAACGCGCTGGTGGCGGTGC
GAATAAACCCTTCTTTTCTAGCTAACTTCGCGTACAGAAGCCAGTTCTCGGATACTTCATTTCGTAGGTCTGCCTCATGCAGAATTACTCGGCGAAGTGC
GAGTATCGGATCACGGTATTTGAGCGGTGTTGCGATGGCATCATACCGCATTTTCCAAGGCGTTTGCTTTTTCCACAGAAGACTGCGCTGCCCTAGTTCG
TCATACTCCTTCATATTTTTTAGAAATATAAATCCCTGTTCAGCCTCGTGCAGGAAGTGGAGCTGATGAAGAAATGGATACGCGCGTTGGTATGATTCTG
CGGACGCCGCGGCGAGTGGTGCCATCACTTCCAGTCGTGCTGCTTCCAGGTGGCGTTGGAAATCATCTTGCTTTCCGCTATGTAAACTGTGGAGAACGCG
CACGAGCATCAGTTGTGAGACAGCGAAACCCTTCAGCCGCCCCCCATCAGACGAACTGGTCGACGAAACAAGTAGCGGATTCTGTTTCTCCGCACTCAGC
AGATCTGTAAGAAGCTCCCATCGTGACAGGCGCCAAGAGCATTCAAGCGCAAAAGGGTACATCGTCGCCATGAATTGAGGTTCTTGTGTAACAATCCCGT
TGATGTGCTGCAACGCGCTTTCAAGTCGCCCTAGCTGGATGAGACAGCCAATCATTCCAGAATAGAGCTTAGGCTTCAGCGTATCTGGGTCCTTGTGTGC
GTTTGCTTCCAACATCTCCGCAGGAGGCTGCAGCATCACATGCTGGCTAAAAGACAGTCGAGTCGGTCTAGACGATAGAGCAGACTGGATTTCTTGGATA
GCTTGTTCGTAGCAAGCTAGCGCATCTTCCCACTGAGCAAGCTGCTCGTGATCAATAATCTGATGCATCAAATCAGTGAGGTTCAGCCCCTCCTCTTGGT
CCTCGCCGTGCAGACCCCCTCCACTATCATTGCGCCGGTACGTGTCGTATAAGCGGCGCAGTGTTGTCAACCCGATAAGTGCGTCCGGTTCGTCCACGCT
CTTATATAACTGCTGGAGATAAAACGCATTATTTGATATCAAAGACAGGTGGACCGGTCCCGCCATATCAATATTGCTGTCTCTTGACTCCGTAGGTGTA
AACTCTTGCTGTCGCAGATAAACTTCAAAATATTGGATAGCTCGGGCGTATGCCTTGATTTGGTATGCAGCGTTTGAAAGCGAGCGACTCGGAATGTCTT
TTAAAAACTCCTCCAGATACTCCTTTTCGTGGTCATCCATTTCGGAGGGCATGTCTGAACGGCCAGAAGCTGATGTCTGGCGGCTGGCAGTGCTGCCACT
GAGTGCGAGGCGCTTTTTCTCGCTGGTCCAAATCCATTCATTCAGTTCATCGATTGTCGAGAAAATGGTCTGGGAGCACTGGTCATGGCGACGAAAATAT
TCTCCAACAGCATTTTCAGACGTGCTGCCGACACTAGTCACTGAGTCACTTGTGTGCTCAGATTCAGGCGGTGGCATTAGGATATCATCCATTAAAATAC
CGCAGTCCTGGTCATTCAACACCGCCATAACCTCTTTTTTAAGCTCCTCGCCAACGTCAGGCCTTCCAGACCGAAGCACATTCTGTATCAAATACGGCAA
CAAAAATCGGGATATTTTGGGGCACGTCACGAGGGCAGTCCTACACGCCCAAAAGATCTTCCGCTCTGGCGGCTGAGAAAGGTGAATCAATCGCCGACAC
CACATCAGCAGCCATTCCTCATATGACGTTCCATACGTTTCATAAAACGAAATATCATCGCATGCAGGGTGCAAGTTTCGGTCAGCACTTGCTGATAAAC
GACGGTCGGATCCACTATTATCGTGACGTGAAGATTTACCGCCCGACAAAGAATAGTTTGTTGACCAATATGGCTCAACGAACTGAAGGACATCTTTCCG
CTCAAATCGTCTTTTCATCCATTCGGGCATGGGAGACCCGGGGCCCTTCCTCGTTTTATAAGACGACCCAAACGTAGTTGTTGATGCCAAGCTTTGGCCA
CTATGTTGTGGATCGGCTGTCAGCTCCCCCAAAAACTTCAGAAGCTCCTGAATTGCAAAAGCTAACGAGTCAGTGTTCTCGGGTGCTGCACGTAGTTCCT
TCAGCAACCATGTCTCTATCAGCGCACAGGCTAAGTCCTTAGTCGAATGTTCAATCTTTTGGTTCACCTTTTCTTTCCCGACAGCAGCAGTTCCTTGCGG
ACCAGCTGCCGTATAAAACATGCTTAATGGCACGCGGGCGCCATCGATTGCACCCAAGGCTCCCAAGCATCGTGCGCAAAGCAATTTTATAGGCTCATGG
CTCTCCGTTCGTGAAAGCTGTAAAACAGACAGCACGACACTAGCAAGCGCTGGATCGACGTATATATCTCCTTCATTCTGCATCAGGGCTTCTAACTCAG
ACCCACGGACAATCAAGCATCGTAACAGTTGTGTCAACGCCATTTCACGAACCGCCATGTCAAGATGATTGACGTAGGCTGAAAGGTTCATCAGGTATTC
ATGTAATGGTCGGCATCTTGGATCGCCGTCATCCGCGTACAAGACAACGTAGATCTCATCGAGTTCGGGAATGGACGGTAGCAACGGAATCTTCGGGAAC
GCTGGCTTCAGTTCAGCTCTCTTTTCGATGAACAAGTACTTGAGGACTTCCACAGCTGCTGCAATGCATTTTGTTTGAGCGTCATCTCTGCCTGAAGGTC
CGACTAGACCAGGGTCACCATTTTTCAGATGGTCGAGAGCCTCAACATTCCAGCATTGACTAGCATTCATGGATCTGTCCTCAAGCAAAATGGCCGAGGA
TTCGTATCCAAAACACGGAAGCAGACTGACAATGATAGAGCTTAAATTCGCCTCCAGAGCTTTCGTTGACATCATTCGCAAGAAATTTCCCCATGCTTGA
ATTGCATGCACTTGCAGTTCACGTTCTGTGAGACCGACCTTTAGAGTAGCCATCACTTTAGGAACAAAAGGATCAACGACCCCGTTACTCGGCGTACTCT
CAGAATATGCCGATCCACAATTATAAAGTTCCAGTAATCGGTCAATGCTTTTTATGGCCCGTATCTTCAATTCAACGACGGTGTTATCGCTGATGCGATT
GCCTAAATCCGTCATGATGCCCAAAAAGTAAGGCCGAGGCATAAACCCCTCTCCAAGTTGTAAACTTGTCATTCGTTCACTCGTCTCCACACCCCGAGAA
ACTTCATTTAAGCAATTTGCCACCTCTCGTATCGCTCTCTTAGCCATACGATACTGTGAGCCGCCAAGCTCCCAAGCTAACAAGTTCATCAACCGCAGCG
GGGAATGTGTAATTACATCACGGACAGTCAAATTTTCTGGCAAGAACTTAAACAAAAATTCCCATTCTGCCAAACGATTATTGTTTGAGACTGCCTGTAC
CTGGTGAATAAGAAGGTCCTTCAGCACATACTCGAGATGATTCAAGAGAAGATTAGCAATAGTCATCGGTTGCCTCCCTTCTGAACCATTGTCAGCCATT
ACAACATCTTCCACTGTGCCGTTGTATTCATCAACGTACGCGCGCAACATCCGTTCGTTTTGATTGAGCACAAACTTCGGAAGCACGTATGGGGCACCGG
CTTTCAAAAACATTTTTGCGTCAACTTTGCCCTCCATGAATGTGCGGAGAAACAACTTAAGTGCCTGAGTCTCTAGCAACTCGTCAACAAGCGGAAAGTA
GAGCAACTCGGGAAATTCGACGCATGATCGTCTCCATGACATCCGGTGGTGAGCCATAATGCGGCAAATCTGGTCGTAAGCAGTCGCTGCATATTTCAAG
CGATTCGCAATCTGGAACCGGTTCCACAAAGAGACCAAACGCAGGAGAATCCACGCGCAATTATCTCCGCGGTCACCTTGCTGCAAGTCACACTCACAAC
CAATGGTACCCGCCGTCAACATTGTAGCCATGATCACACTATCATCAGAGCTTTCTGCTGCTGCAGTCAAAAGAGCCTCCAGTCGCTCCATCAGACCAAC
AGAACCATCCTTTGCTGGATCAATCATTGCATCGAGAAGTCGTGGGTGCTGGACAATGGACTCCAGAATGGCTTGACGGATAAGCCCCGAGGGACTTTCA
AAACCATTCAAAAGGAGCTCGACAAATCGCATGCCGGTTGGATCTCTTCCCAAATCAACCTCACAATGTTCAAAAATGCTGGACATCGCGTAGATTTTTA
CGACACGCACGATTTCGGTAGTACTGACCGTAGCATCGCAAATTATGGGCTCGAACAGAGCTAGTGGAATGGGCAGCAAATCGAAACTGTTTGCACTGTT
TCGGCATTGGCAGCTCTTAGGGCGGCAATTTCCAGCGCAAACTTCCCCCTTGTTGAGATGATTCACGACACCAACAGATGCTTGGCCGTACGCCACTGCA
CATAACACTGCTCCACACGTTTGAATTATTGCTGACGAAATTAATACCGACCCCGTGCGTTGGATCTTGTCGCTGAGAGCTTCTACGATGCAGGTGACCA
TCTTTTTCGGCGAAGTGAGCGACCCACAAACGACAAAAAACGCTAGAAGGGGGAGCATAGCAAGATAGGAACACACTGCCGTATCAAGTAACGTATCCTG
CAATATTGCCTGATAGGCAACTTTCCAGGGAAGAGCATTCCGCCAAAAATCCTCACCGGCGACATTAAGCGTCGTCGGACGTGACCACACCAAGTATACC
AACATTGGACCGCGTAGGGCTGCAGGTTTCTGGAAAAGAGCATCAAGCACAATGTCTCCGCTACGAACGCAATCGTACGAGACTTCAACTAGCCTCTCTG
ATGGAGGTATGTCGTGACAACCCGGGTGCTGCTGGTACAGTTTAAGAAGTCGACATACTCCCAACAATCAGGTGTTACAAAGGTTTTGTCCCGTTCAATA
CTTTGTGCAAGTATCTGTTGGGTCTCGACGGTCTCAATGACCTTGGTTAATAGATTTCGGTATTTTTCCAGCTCGTGGTCATCAAAATAGCGAAGCAAGG
TTAGCCATAGATCCAAGTAATCGGATGTAAGCGCCGTAAGCGAGGGTGCATACGTGTTCACAACCAAATCCACACGCTGAAACAGTGCTCGGAATATGGC
AAAACTTTCTAGGCGCACAAAGGCCACAATGTAGCGACGAAGAGGTAAGATGATCCGTAAGCTAGTCGAAATGGCAACAACATTTCTACGGTCTGTGCCA
CTTCCGATCGAGATTAGATCGAGCACCCACCGACTCAACTTTTCATGAAGCTCACCATTGTTCTGGCGGTGCCAGCCAGACGACGGTCTTTGCTCATCCA
CAGATATTTCACTTCGCTTTCGCTTGCGAGCTATTTTGCTTGATCGAGTTGAATTGGACCCGCTGTTCGCCAGCGACTTCGAAATGAGGCGAACCACCTT
TATCAACACTTCCTTCGATGACAGCACACGATGAACACCATCAATGATGCTCGATCGAAATGATGGGCTCAACACTCTAATGTCGATGATCTTTAATAAA
TCCACAAACAATGATGAGGGGGACGAGATATTGGATTGGCGAATGTATACACACAACACCGAAAGCACCGACTTCCAAATCATTTCCGCACTAGTTTTGC
TTTCACGGCCAGCAACGTGAACTAAATGCATGTTCCCAGATACCCATGTCTCGAACGGCGGCCAGAGTACATCCGTAGCAAACGTAGAGAGGCGCGGATA
AGCTTCCCCAATCAGTTCAAGAATCGCAGCGCTCGCTTTAAGTATCCGAGGATTAGTTTTATGAATCAAGCTGGACTTCAAGTACATCAGCGTCAGGCGA
ACAAACCGCCTTTCCGAAGGTACGCTGATCTTCAACATCGTGTGAAGCAGTCGAAACGTACTTTGTATGACTTCATCGACGCTTTGACTGGAAACAGCCC
CGGTCACGTATGTTTCCCCAGCGCTTTTCACAAGCGTTTCATTCTTGACAATGAACAATTCCACTAATTGGCATAACCTGTCAAAAGATTGATCCTCTTC
AACCATCGCATGATGCTCACGGGCAATTCGGTCCGCTAGCACAACCACCGACTGCCGGAGAGTCACAACCATGCCGTACGAGCCAACTTGAATCGAAGGC
AGCATCTGCTTCAGCTGCTCTCTACGTTCGTAAAGATGGCTCGAATCCGTAATCGGCATACATCCACATAGCGTAGCAGTACTTTTCGCTCCCAGCGGTC
CATCAGCATCTTGGTACACATGGATCGCCGTATCCAAGTAGCACATGATGTTCGCTCCTCCAGGCAGCAGATCCGTCGCTTCTCTGTTTTTAAGCGACTC
CTCCAGCAAGAAACAGTCCTCCAGTAGCAGCACGGTGTCTCGAAAGAAGTGGATGAACCCGTACACGTCGTTTCTCTGGAGGAACAAAATCATCTGCAGC
GTTACGCCGCGAATCTCTCTCTGGGCCTGTCGCAGCCTCTCGTTCGTGTAGAACGACACCATGTAGAACAGCATCGTGGCCAGCGTCGGGTAGGTCGGGA
AGCCTGACGCCGAGGGGTCGTCGGCAGCGCGTGAAGCGCCCGTGTTGCTCTCCATGAAGAGCGTCATGGAGTGCGGACACGCGCTACCGCCCAGCAGCAG
CGCTAGAAGCTGACACAGATCCTGCAGCACTAGCACTGCCTTCTCCGTCGCCAGCGTCGCCACTGGGCGCATGAGCTTGGGCAGCAGCTTCCGCAGCTTG
GTTAGTATAGTCTTGCAGCGGCGGATGGCCGCAGGTGAGCCCGAGTCGTACGCGCGGTCGTCATGCTGCCGCTGGTGCGCACGAACGTGCCGCAGTAGAC
TGCCTACATCGCTCTTCTCCGCGTCCTCGACCAGCGGCGGCGCCATCCCGAGCGTCGTCATGGCAAGTGGTGGCGAGTGCAGAAGACAAACACTCCCACT
TCAACGTACTTAAGTGGATTGTACGTGGTGCGTTGTACATAGGTTGCGCGGTGATCGCACTAAGTGCGCCCTCAACGCTTGGCAACCGCACGCTCAATCG
AAGATGGCGACCAAGGGTGTGTGGCAGCTCAAGCAGGTGACAATCCGTTACTGCCAGCACGGCGGCAGCAGTCGCCACGTGCGACAGCTCCTGGGCGACG
AGCGCTTCCTCAAGTTCGTGGAGGCGAACCCGCAGGTGCAGTTCGAGACGGAGCTCAAGGGCGCGCGCCACCCCGTCCTCATCGGCGACTACGGTGCGTA
GCGGGCACTGAAATTGCGGTTATGGATTGCAAATGGAGGTGCTTAAATGACGTTTTGGCTGCCTAATTCCAGTGACAAATGAGCGCAAGGTCAGCGACAT
CAAGAACCAGGACATCCCCTTCATCCTGGACCAGGTGCGGCTCACAAGCGATTGACACACAACGCAATACTGTCTGGACTGGTTGTCAGCGTTGCTCCCT
ACGGCTACTTTGCTAACGGCTACATGTGATTATGGTGGCGGGCAATTCTTCTGCAGCTGGAGCGTCTTCGTAATTCTAGCGGCCGCAAAATGACGCACAT
CAAGAAACCCGTGATCTCCAAGCGCCCGACCATCCAAGGCATCTGGCAGCCGGACCTCGACTTCCCGGAGTTCAAGATCAGCGACCGCACGTAGACGTCG
ATGCTACTGGTTTGGGAGAATGCAGTTTTCAGGGTCGTTAGCGTAGCTCATTAGCAGCAATGGAGTTCACTGAACACTGCAACAGCACTGCACAGGCTAT
CTCAACAAGTGAAGCATCAAATATATTCCTTCAACAGCCGCCGAGAGAAGGGAAGAGAGGTCCACCACCTCGTCTTCCACCTCCCCTCTCTTCTAACTCT
TGGAACTACGAACTAGCAGGCGTGTTCACGCCGCTGCGGTAGCTCAAGCTCAAGCTCAAGCACCAGTGGCGCCATCCAGCTTAGAAACCGTGCAGCACCA
CCTGGGCGTCCGTGCAGATCTCCTGGTCCAGCAGGAACTCGCGGATGTTGGTTCGCTGGTCGCCCGACAGCTGGATGATCTCGCCCAACTCGTCGTCCTT
GACGATGGCGCCGTTGCAGCTGAAGTTCTTCTTGAAGGCCTTGAGGATGCGCTTCACGTCCAGGTCGTCGGCCAGGCCCTGCACCGTCGTCAGACACTTG
CGGCCGTTACGCTGCTGCACACGCACGTGAACCTTGCCACCGCCGATGCTCGAGTCGTCCTTGGCGTCGGCAAAGGCGTCTAAAAAGAAGCAATCAAATC
AGTACAACGCTCCGCATCTACCTGACTACTGTACACCTCCATATTCACCCTCCTACTTCCGCAATAACGCACCGAAGGTCTGGAAGTTCTGGATGTCGGC
CATATTCGCTACGTG