Description :
From Genome Similarity Track
Location :
Scaffold_72:52346- 54517
Transcript NameFunction/comments
g13593.t1hypothetical protein

Sequence
2171 bases(100 bases per row)
CAGTGTCCCGATTCTCGTGGTTGGAGTCAAAACCGCAGTGGTGGAGAATTTTGCACTTCGGCAGGCTATTCGCCACACATGGGCGAGTGTGAACGCTCTT
CCACCAGATGTGAAAGTGATATTTGTGGGATGTGCGCCTGCTCTGACTGCACTCCAGAGTGCTGATGAACAAGAACACATTCGAAAAGCGGTTGACCTCG
AGAAGCAGACGTACGGCGATCTACTCACCGATGAGCTGCACTGCGAGGACTCGTACGATGACCTACCAAACAAGGTGAAGGAGTTCTTGCGATTTACCAC
GGAAGCATTTCCACAGACGCCATTTGTGATGGTAGCTGATGATGACATTTACCTCAGAGCTGACCGCCTCGCCGACGAACTGCGAAAGGAAGGTCGCTCC
GAGAGACTTTACATCGGTCAGGTGTGGGATGAGCTTTTAGGTCGCCGCCAAACACCCGTGCGCAATACGACAGAGCGGTACTATATTTCTGAGAAAAGCT
ACCCGCTGCACGCGTATCCTCCATTCGCATTTGGGCCGCACTACCTGCTGTCGATGGACTGCGCACGCTTTATTGCTAAGAACCGCGACAGATTGCACGG
ACTCGGTGGGATGGACGATGTCAGCATCGCGATGTGGCTATTGACGAGACAAGTGCATGTAGAACACACGCCGGCATTTTCGAGTCTCCAATTCCAAGAA
TGCGATGGTCGGATTTTCTCGCTGGCAAATCTGTCACCGTTCGGAATTCAAGTTATTCACGCGAATCTAGCTGAGAGACGTGATTTATGTTATGGTTTTG
ACCAGTTCGTGTGGCAAAAGAACAACAATCATCTCGATTCCGAACGATCTTCTCGACAAGACCATGCGCCTCAGTGGGAGATCCAAACATACGTCCACGA
CCTCGAAAACACGGAGTACCTCTTGGTCACGAGTATAGTTTCCACGCGAGAGAAGGCTGGCGTTAAGGTTTCTTACTTCCCGTCGGCGGAGACGTTTCAC
GCTTACTCTCGGCGAGTATGTCTCGAAGTTTTCTCTTTTGTCGCAAGTTTAGATTACAAATCCTGGATGTGCCGTGGAATTACCCAGAAATTACGAACTC
AGCTTCAGCAGCAGTTCCACATTGCCGAAACCTCGGGAGCAATCAGCCCTGCATTCCTGGAATTATGGCGGCATAACCTTTTTGTTGCCGATCAAGACGC
GTCGCCATATATTATCGCGTACTCACCAGAATCGTCATACGCATCGGTAGTGTTCGAGTGTATTTTCAAGACCATATTCGAGAGTCAAAAGCGGCCAATT
CTGGTCGTCCCTGAGGAAGCTCTTCATGTGAGCTATGGAAATAAGCCGGATGTTTTCGTCTTTTCGATTTTCGATGCCGACTGTGACCCAATGTCAAAAC
CTACATGTCCTGAAATGATCGCATACTACATGCATCACTATTTACCTCCAGCTCGTGAAAACGAAGGAAGGCACGTCTCAAAACTTATGATGATATCAGG
CGAGGCCATTGACACCCAATATCTGGACGATCAAGTCCCCTTACTGTCATCAGTTTCTGATGTACCACGAAAGTGGCATGTGTACTTACCGGTTGCAAGC
ATTTCGTTTGCAGAACGCTTACGACACACTCCTATGGCACTACTTTCACCAGTACCTGTACCAGAGTCTGTCGAACGTCGATTTTGTGCGTACTTGTACG
CGCGTTGTGATCGGCCGTATCGAGAGACTATGTTTGATCTACTGAATTCCATGGAGCCTGTAGACGCCCTTGGGGTATGTGCTGGGTCTTCAAGACCACC
CGACAAATCATACCAATTCTCGCGCTACTCCAAATGGTTCAACGATGAAGCCGTTATCACGTACCAGCGTTACAAGTTTGTTGTCGCGTTCGAAAACTCA
GCTGAACCAGGATACGTGACGGAAAAACTCGTCAACCCGTTACTTGCTGGCAGTATCCCAATCTACCAGGGTAATTCTACTGCTGCATCGCTGCTATTCA
ATCCGGACAGCTATATCGACTGTGGTCGCTTCGAAAAGCTAGCAGATTGCGCAGAGTATGTCTTGCAAGTCCACAAGTCGCCAGCACTCTACGCGCGGAT
GCGTAGTGAGCCACCGATACGAAATATCACGGCATTCAACGAAGCTTTTTCATGGCACCCTTCCGTTTCGA