Description :
From Genome Similarity Track
Location :
scaffold_12:523432- 526938
Transcript NameFunction/comments
Plaha_PHALS_13277Predicted membrane protein
Plaha_PHALS_13278Leucine rich repeat proteins%2C some proteins contain F-box

Sequence
3506 bases(100 bases per row)
GAATTTACAAGGCGATCCACGTCGTCCTGGTGATTTGCACCCATTTGTGCGGGAACGTGTAGATCCTGATGATGCACCAAGCGACTACTACTCGTTGTTT
TCGCTTGTCCTAGGCTTTCTCGGCTTTATTTTGAAGGTAAAGTAATCGTTTATGTTTTTTGGTTAGTCATTTATCTAATACTATGTAAATGTCTAAGTGG
AAAGAGATGGCCTGGGGCTCGTTGGCATTGTGCGTGGGTTCATTTATCAACATGAAGTCGCAAGACATGAATATGACGCAAGTGGTAAtgtccttcttct
tctccacTTCATCCCTCGTGTCCGCATATATGGGCGGTATGATACCAATATCCCAGACTATTAAATCCCCTACTTCTTAAGGCAGTTAATATTTCTAATG
AAGGATTGATCATTGTGAAACGTAACCGTTTAGAAACAATTTAGGACAACTAATCATTTAGGTTGAAACAATGTCAAGTTATCTTCATGTAATATCTGAA
GCAAAAGGACGGATAATAGAGGACTCACCTCGTAAAAGTCAGGAACCAATTGGCCATGTATTGCCTCAAAAGCTGATCAAACGACCACCAGGACGACCAC
CAGTCAAGACGAATGCTTTCATACCAGTCAGCCTACCTCCTATTAGGTCCGCAGATTTTCAGGTACAAAATGCACCAACACTGGAAGAGAAACAGCAACG
ACAAATGCGCTCATTTTTGCGCAATTTTTTATCTGAAACTGGtaaatttcaaaaatttatCAATCTGCAGCAACATGAGGTGGATTCTGGCATGCCAGTC
ACAGATGCAACAGTCCAAGAAGTGGTCATCACTCTGCCACATTTGCGTGGCTTGAACCTATCAAATTGCGTTCATGTGACAGATGCTGGGTTATTGGCAA
TAGCTCGACACTGTAATCCAGCGTTTGATACAATCTATTTGGCTCACTGTGAACAAGTGACCGAGCTTGGATTGCGTCTATTGGCACATACCTGTCGTCT
TGTTTATATTGATTTAAGTGATTGCTCACAATTAACAAATACTGCACTTCAAACGCTCGCAGCAGGATGTTGGACAATTGAGACACTTATATTGAAACGC
TGTCGTGGTATCTCAGATCCCGGTCTTGTTACAATTGCACAATGTTGCAAAAAGTTGCAACATCTTGATGTTGCAGGATGTTTGCATATTGGAGAATATG
GAGACCAAGCATtagttgcacttggtacatTTTGCCTTCACTTGCGTTTCCTTGATCTCTCTGGATGTCACCACGTCCAAAACTTAGGTCTTCGTACTCT
TGCAAAAGGATGTCGTAGGTTACGTACTCTACGACTTAGTCAGTGTCAAGATGTGAGTAGTCACGTTTTCGGGACACTAGTGCAACATTGTACGCAACTC
ACGACATTGTCACTTTCAAATTGCATGCAACTCACAAATGACAATCTGGTTATGTTAAGTACCCACTGTTGTCAATTAACTCATCTCGATCTTAGTAATT
GTCCAAATATTGGGACATTTGGTCTTCGTACACTTGCTCAACACTCTTCATTTTTAACATCATTACGTTTAGCAAATTGTAAACGTCTCGATGATCAAGC
ACTTGCTGAATTTTCTAGTCCAATTCTACGAAAAGGATCATTTGAAAAGTCTTTTCAACTTACAGAAGCTGGAATTGAACATTTAACTCAATCATGTCCA
AATTTATTGACACTTAATGTGACGGATTGTCCTCAAATTCGTCGAgaatttcttcatcatctcatTGCAAAGCTTGAATTTGTTCAATGGAGTTCTCAAT
TCATTGGATTTGAACCACTTCCAAATGCTATGGAACTTTGTCGTCAACGTGATTATCATTCTTTGGAACGTCAATGTGCAATGAGAATTCAAGTAGCGAT
CCGTCGAAGATTTGTACGAAAACGTTTGAAGCTACGAAGAATTCAATATCTTAAGCTAAACGTCGTTCCAAAATTTCAAGCACATGTTCGTGGCTATTTC
GTACGCCAAGGtattaaaaagaaaaaggatCAACAGCTTCAAGCACAAGCTGCACAATGCATTGGACGTGCGTATCGAAATATGAAATTTCGACGGAGAT
TTCAACAAATACAATATGATCGTTTACTGAAACGAGAGCTTGAGACTGCAGTTTTATTAGTACAAACGACATTTCGACGACTTCGGGAGCGTAAACTTGT
GAAAAAACGAAGCGATGAAATGTTTAAGGAAGAGCAAAGACAAGGTCGAATCTTAGCAAGGCAACACATGATCGCAACAAAAGTGCAACAATTGTATCGT
GGATATCGTGGTCGACTTGATGCTATTGAACGGCGTTTAGAAAAGAAACAACAACAAGTACGACACGAACGCGAAGCTTTTGCAGCGACGTATCTTCAGT
GTGTGTATCGAGGCTACAAAGGACGAATTCTTCGAGCTCAACGCTTTGCTGAGATGCGTTTTCAATTACAACGTCATCGAAATGCTGTTAAGATACAGCA
ATTGTTTCGAGGATATCGAGCACGACAACATGTCGAGAGATTACGCGTGGAAGTCACGAAAGAACGAAGACTTCGAGCGGCAATTACGATTCAAAGGTAC
TGGCGAAGTCTTTGTACTAAACATCTAAGTgctgtatttcttggtttaCTTAAGCTGCGAGCTCGTGAAAACGAAGCTGCTCAATCAATTCAAGCGGCAT
TTCGAAGGCATAATTCACGAGAGTTGATAACAGCAATGAATGAAGCAGTTGCAATCGAGAAGCGTCGTAAGAAAGCTACAATTGATATTCAACGCTTGTT
TCGAGGTTCTCGTGGACGAGCAGAGGTGGAAGTCAAACGAGAATTGCTTCGCTTTCGACACGATATCGAACCATTGATTGCGAAAGAATCACATTTGCAA
ACGGTAGTGACAGCATTAAATGGGAAAGTCGAGCAATTTCATATTCAAATAGCTGCTGATGAGCACGAGGAACAATCTCTTAAGGAAGAACTTGAGAAGA
CTTTGGTAATCAAGACGAAGTATCATGATTCCAGTCGAATCTCTGGAACTCTGCAACGTTATCCAACACAATTTATTCAAGTTCAGCTTGCAGATGAATT
ACAAGCAAAACGTGCCGAAATCTCACGTCAGAAACAAGCTATTGAGACGTTAAAGACAGAATTAAGTGATCAACAACGTCAATTGCGAGCTGTGCGACGA
GAACTTGAGCCGCTTACGCAAGGTCTCGTTCAGAAAACGCGAGAGAATCGAGTTCATCGACTTCAGATGAAGGTGCGACGTGAACGACAAGCAGCAATAC
GAATACAAAAACTTTTTCGAGGATTTCGAGTAAGAGCAGCATTTCGTGAAGGTGGGAACTACTGGATCAAGTTGGATGTTCCATCTGAGTCTCAAAAGTG
TTTCTGTAACGTAGTTACAGGCGCAACCCGACGGTATCGACCTTTAGCTATGGATTTTTTTCAAGACAATTCGcaaaaattgttgaaaaAATCTACAGAA
GCAGCA