Description :
From Genome Similarity Track
Location :
Scaffold_27:5234- 6957
Transcript NameFunction/comments
Phyta_totarag1439hypothetical protein

Sequence
1723 bases(100 bases per row)
TTAACTCACATTCAGCATTGCAGTAAGCTGCAAATTCCCACCTTGCCTCGATCGAGGAATCCACAAAAGTAGCGAACCACCTCCTGTACCAGGAAGACCC
AAAAAACCTGGACGCCATCGATCCAAATACAGTGTTTTTCCTCCTAGTGTTGTCACGTTCGACTTCCAAGTCGCGGTTTGACCAGCTGGgacatcaactt
catcagTCTTGTCACCTCCAGACTTGATATTTACGGTCACATCTTTCGTATCAACGCTCTTGAACGTAATTGTGACGGTGCCGTCGCCAACCTTGGTCCA
CATGCCGTCACTGTGGTTGAACGCGCCTTGGACAATCGACATGCCCAGTGCCTTTTCCGCAGTACCATCATCAATTTCACCAATGTACTCCGTAGGTCCG
CAAATAGGCTGAAAATACTCGGAAATCGCTCCAGTGGCAGACCACGGGTCCCAAATAGCCCAGAAACTGAATGCCTTGTCCGCAATGTTGAATGCGTACT
CCTCAGCACTGAGAGCTGAACCATTATTACTCGTTCCCGAGCTAATCAGATCGTCTACAATTCCTCCAAAGGTCTTCCGAAGCGTGTCGCGAGTGGCGTA
AGCAGTTGCTTCATCCGATTCTGCGATCAGCTCGCCCATACAATTATTTGTTGCGATAGGGATATCGTTGAGTACGAGGTTCGACTGACTCATGACCACT
CGAATGTCGTCCTCAGACATTTCCGGGTTCTGGCTACGAAATTCAGCCACAGTCATCCACGTGCGATCCAACAGACGCTTCATGTCGTAGCCACAGGTGG
AATTGGACTTCAGCGCGGACTTCAAAGACTTGATATCTGACTTGTTCAGTGAGGCAATCGAATCGCCTAACGTAATATTCTTCATAAAGTTCGTGAACTT
GTCCCAACTGGAGAGGATAGCGGCACCATTTGATACGACTTCCTTCAACACGTACTCTGCAGTCATAAGTACACTGTCGGCAAACTTGACATCTTCAGTC
ACGGAGTTTCCGATGCAATATGCGACGGCAATGGGTATATCAATAACGACGTTGTCTGTCTGATAAAGCATCGCCAGTAGCTTGTCTTGAGGGGTCTGTG
GGTCAGTAACCTTGATGTTACGAACGTACTTTGCCAACGACTTGATCAAGCCCATCGTGTACTTGGCGCATTTGATAGCGACTTGGACGGCCCTTgccag
cttcgccagctTGCCAAAGACGTCGTACGTGATCAAAGACAGTGTTGTTTGGGCCAAAGCCGCAACTTTGGTCACGATTTCGAGTGCACAGTCGTCGTTC
TGTCGGATACACTCCAGTCCACACTCGACAGGGAATGAATATGGGCATTGTGCCCAACACGTTCCAAGCTTCTCGTCGAACCCTAAGGGGCACGTCTTCG
CGATGTGAGCTTCGCGGTAACACGCTGTGGTTTTTGAAGTATCGAGTGCGGAGCCTACCCAGTTCGTGTAAGTGGGCTTGATCGTGCTGGTGGCATTGCG
AATGCTGCCAAACTGTAATGCCGCGCTTGTTGACTTTGAGTACGCGTTCGAACCTGCAGATCCGTCACCCACTTCCGAAGACGCGACGCTGGTCTTGTCG
GTAGCCTCGCCGCCATCGCTTTGTGAGATGCTAAAATCGTCACTGTCGGAGGAGTCACTTGCGCTATCCGTCGAATCGATATCGTCACTGTCCAAAGAAT
CGAGAGaatcgtcgtcgctggtg