Description :
From Genome Similarity Track
Location :
scaffold_17:523274- 525831
Transcript NameFunction/comments
Plaha_PHALS_11155hypothetical protein
Plaha_PHALS_11156NADH:ubiquinone oxidoreductase%2C NDUFB9/B22 subunit
Plaha_PHALS_11157Ankyrin

Sequence
2557 bases(100 bases per row)
ATGGTGTCAAGAGGTTCGAGAATTCATCATACACGACAAACAAGCAATCCATTCATGATAACGAGTTCTGCTAATGTTGGTATTGATTTCAATGAAAAAG
TGACATTTCATGCACCTAAATTGAGTAGCAGCTTGAGCCAAAATGACACTGAAGATGATTTTCAACGATCAACAAACACTTTGACTGACTTCATGTATCA
AACAACATCTGGAGCTTTTGGAAATATTTCTCAAACAACGAATCGTAGTCGATTGAGTCAGCGAATGGATAAATTGACAGTTCAAAAAGGTTGATAGAAA
AGTTTTGCATCTGAATGACTGACTTTTGGTACTAATGTCGTCTTGTTTACAGAGGTTAAAGCTTCTGATCTTGTTGTCATTCGACAAGTTGATGTAGTAA
CACCGGAAAGTTGTGCTATTCGGCCTGAGGATCTTATGCCTACACCTATTGACGTCAAAGCGATCACGGAAGGTCAGAATCAACATCCTTTATACGTCAC
TAGCTATCGAGACATTGGTGCCGACAAGGCACAGCTGAAGGTTGATgctgcacgacttggtcggcCAAATACCTTTACAAACTCGTTCAACGGCTTCCAT
TATCGCGATTTTGGATTAAACACTGCAGTGTCCAAGTCCCGTATCTGCGATCAGCTGGATTTTACTTAGATTTAACATTCATCTGACTCCAATATGAAAA
GAGATCTACAATTCAAAACGAATGTTTTTTATTAATTCTGTCACCCTTACAAGCACCAAAAGCGTTTGTAGCAATAGCATTGATTTCTTCCTTAATCATA
GCCTTTTTTCGAAAAGTCGACAAAGACTGTTTCCTTTGCAGGTAACGGCGTCATATCAATGTTAATGCCTTCAAGTGGTGAGACCTCAACGTCGTCCGGA
ATAATTCCATCTGGAAAGCATACATCCAATGGAATGGGTGCGTTACGCATATAGAGACTTCCTCCAGGCATGTAGTTGAAAATATAGCGGTCCGGATGCG
TATAATGGTCCACCTTCTCTTGTGCTTCACGCACAAGGCGCTTTGCCAGACTAGAATATATCAACAGTTAACAATACATAGCATAAAGATTAAATTCTCC
ATATATCTCGTACCCTGATTGAGGATCAAGCTTTTTATTCGCATCAAACTCAGCACGAATCTTCGTAGCCTCTTCATTCCAAAGGCGGCGGTCGATAATC
CACGAATCTAAAGTCTTCAGCGACTTCTTATACAAACGCTGTACCGTTTGCTTATGTGAAAGCTGTGGTGGAGCATTGACAAAGCGTCCAACTACCTCAC
GAAACGTTTGATTCATATTCGCATTCACTACAGGCTTCACCATCGTCGCTTGACTTGGTCATTCAATTCGAGCAACATTTGTAAAAAGTGGAGTGTTGCA
TGAAGGTGTTTAAGCCGTTATGGCAACGTAGAAGTCTTATGTTGCTACAGCCGTAATTAGCAACATGGTCATGTACAAAATGGAGCTTAAAGTATCTGAT
TGCTCAAGACGCAGCCAGATGAAGTATGAGCTTAAGCGAAGAGAGAAAAGAGATGCAAGTTATCAATTGACGAACTTGTTGCAAATGGAGAGTAATCAAC
TGAATGAAAAGCTACTGATTGCAAGCGAGAAGGGAAATGAACGTGGTGTTTTTCTTCTACTTCATCAAGGTATTGACAAGGATCGATGTCGAGGTCTTGT
GAGTATACATAAGTTAAACATTCTAGCTTGAAGTTGATAGTTTGCAATTCATTTTGATTTCAGTTTGGGTATTCGCCAATGCATCATGCTGCAGCTCGAG
GACATTTAAATATCTTGCAACTATTGCTTGATTTTGGATGGAATGTTGACATTCGAAACGATGCGATGGAAACTCCTTTGCATCTTGCAAGTTTTAATGG
TCATGTTCATGTGGCTGAGTTTTTATTAGACCGTGGAGCGGAGATTAACGCTCAAACGAAAGAGAAAGACACTGCGTTATTTTATAGTGCACGTAAGGGA
AAGTATCGAATTGTTCGGCTCTTGCTTCGTCGAGAGTGCGATTTACGCATTAGGAATTGCTACGGTGATGTGGCAGAGGAAGAAGCGCTTGATGCTAAAA
CTTTGGATGAATTTGTTACTGGAAAACAAGATGTTGAGCGTGCGTTAATTGCGCAATCTCAGCGGATAAACATGATTCAGGTTGACGAAAATGTTTTACC
TCAAAAGCTTCGAGAGCATATAATGTCGTTTCTGGATCTTAAAAGCCTCGGCTGGGCTTCTCAAGTATCTCATCGTTGGCAtcgagctgctgacaatCCG
ACTTTATGGAAGAAACTTGGTGTTTCACGGTGGGGATTACTACTTAATGCGACTATGGGGACAGGAATTGTGCCTCAAATGCTTCTGCTTGGTTCAACAA
CGAGAAacctctttcgcttaaatCTTTCAACAACTGAAACTCGACGTCCATTTAGCTGCAATCAATTTTCTACGAATACAAATCGACTGCCAAGAGCTCA
AGGAAGAATTTGTACGCAGTATCAAGATCAATTACGACCTCAAACTGCTAACTTTAC