Description :
From Genome Similarity Track
Location :
Scaffold_51:52317- 53770
Transcript NameFunction/comments
Hyaar_Emoy2806479hypothetical protein

Sequence
1453 bases(100 bases per row)
TTCCACTGCGACACGTTCTGCACAATCACTATGGTCTGTGCGTCCGAGCCTGCAACAAGCACATCAGACTCAGCGTGAATCGCCAAAGCGTTCCATGGCT
GGGACCCGGAAGTGAGTTGCTCGACGTGGAGGCGCCTCGGTCCCTCAAAACATTTGTCGGATGAAGTGGCAAGAGAGCCGAACGGGGTCGCACTCTGGCT
CTGGCTGCTAGTAGACTCGCTGTATCGCTCGTATTCGACTGGATCGCAGCGATTGCGACCATGGTGAAAGTCCCAGCAGTTCACCACGCTGTCGTCATTA
CCCGTGTAAAGGTACCGAGGAAACGCAGAGTGGATCTTCAGCGCTCGTACGGCACGATGGTGGTGTGTATCAGTTCGGAATGGTGCAGCAAGTTTACGGC
GATCCCACAAGCTTACAGAACCGTCAGCAGCTCCTGTGATAAGTAGCTCGGGCCGCGTTGGGTGGGTCTCGAGCGTAGTCAAGAAGGTTTGTGAACGAGA
ACTGCATTTTTCAAAGCAAAAGAAAGCATCAGCGAACTCATGTGCATCACGAATAGCCGTACATGCAGACGCACGTACTCAGCAGAGGTCGCGACAGGGA
ACTGGTTGTTTGCTGCGAGGTCCCAAATCCGTAGCTGCTTGGCTGGAGTTGAGCTGTCAACGCAAGAGAATCGATCAATATGTAGCCAGCGACGTACAAC
AAATTAATGTCTTTACGCGGTCCTACCCGACAGAAGCAACGACCGAGTCGCGACCGAGAAACTTCACTGCATTGATCGGGAGTCTACTCACGTCATTGTT
CTCTGCGTCAACGTTAACATCAGCATTTTTCCACAAGCTCCTATACGACGTATGTCGTGTGCACGTCCTCCACCCATATTCCTCACCAATTTTGACGACA
CTCGCAACGTCGTCCAGCTTCAGCCACGCCAGAGCTCCATCAGCACTGGCAGTCACGAGACTCGTGCGAGCTTCACTGACCTCGACGCACGTTGCTGCAA
TGCCAGCAAACACTCGTTCCCACTGCGGTATCACATGCACGTCCAACGGCTTATCCGCCTCTTCATCCGTCATGACAGAATCATCACCTGCAGTGCTGGA
CGACACACGATAAGCAAAGATGCCGCCCATGGACGACGCGCTGACCAGCAACTTCTTGTCTCGAGTGGCCACAAACTGTAACGCGTTCACGTCTCCCTCG
TGCTCCGTCTCAGCCACTGTCTTCAACTCACACGTCCGTACATCACTCGATTTTCGTCTAGCAATAGAAAAAAGCAGAAAAAGAGAGAAGGAGAAGGAGA
AGGACAAAGAGACACGTGACGTGTGAGACTACACCTGCCAATGCAATGGCTACAAGTCAATTTAGCTACCAAAAACGCACCCATACTCTTTGCCCAACTC
CCGCTCGTCCAGTGACCACCGCACAGGCGCGTGCAGCGTGATGTGATTGGTCT