Description :
From Genome Similarity Track
Location :
Scaffold_88:52309- 55598
Transcript NameFunction/comments
Phymu_g3948conserved hypothetical protein
Phymu_g3949hypothetical protein PHYSODRAFT_477368

Sequence
3289 bases(100 bases per row)
TTCTTTAATTCATCAACGACGAAAGCTGGTTTAAGAAATCCGTTGCCTTTTTGGACGCAGCAGAATCGACCTCAGTATTTGTCCGCGTATCACTTCCACT
TGTCACCACTGCATCCTCCTTCTGTTTACGAAGACGCTCCAGACGTAGCTGCTTCCTGGACTTTCTATCCATTGTGTTTGCAGAAGACGAGTGCGTCAGC
GACTGCGCTAGCGTCGCATGCTCGTGGACTTCCTTCAAATGGTCCTTCTCCGACGGCTTGAGACGCTTCTCCCACTGCGAAACCACAAAGCTCCCGCCAG
GAGCTTTATCTTCTCCTTTCCTGTCTTCAACAGCACCATAACGTTTAGCTTCTTCCATatgctgttcttgttgcGTCTCCAGGAACGCTGTGTACTCCTC
ACTGTCTGCCGCAACTTGTTTTGTGCGCCCGAATTCGTCCATGATGTCCACCAATGTTCTCTCCCTGGCACTCACGAAATCCTTTTTCGCATCAAAATTC
ACTAGACACTCCCCCTTCAGGTGGTTTTTGCCTCCGTTAGTCATCTCCTCGTATAGttttgtcttcttcagcagcatttcaGCTGATTTTTTAGCCCAtg
cctcctcgtcgtcttcgtctggGGCTTCTCtcgacttcatctcctcATCGCGTCGATTGCGAGCTTCCACACCTCTGTTGCTATGGTTCTTCCCTACGCG
GTCCTCTTCTGAATGCTTGTGATGCTTGTTTCCGCGCCGCAGATGCGCGAATTTGCTTAAACGGAGGCCTCGGCGATCACctggagcttcctcgtcATTC
TCGGCTGTCAAAGCCTCTTTCAGGCGGCGTTTCCGTTCCTGGTTTTtctggaagacgacggccTTGAGATCCACGAGCGACTTGGTGTCAACcttgatct
ccttggccTTAGAAGGCACAAGAGCCGACTCTGTCAAGAACCCAAGCGACATCCTGCTTTTCCAAATGgtttttgttgttgccaGATTTAGGATTTACAA
AACCATGACCTAAATTGATTTTAAACGTGGTGTTAAAAATCTAAATTTAGATTCTAAATTTAGATTGTCATTTTACAGTAGATCATGGGTAGAAACCTTA
ATCGGTGGTTACACACTGTATTTCTGCTTCCTAGACGATGGATGCTAGGCGCTCTCCGTTCACTGTTGTACAGTGCGTTCGCTCGTCCGACAAGCAGGAC
CCGAGTGGAAACCTACTGAGGCTGCGCATCCGTCATGTTTCGGCGCAAGCTGGTCAAGCCTATCGTTGTGGCGGTGGCCAACGAAACGGATGTTGAAGCC
GCCAACCtagaagaaggtgctgaggCAGAACAACCACAATCGGCGTCACCTGCGAAGCAGGAATCCTCTCCTGTTCCGAGAAGCATCAGCAGCTCGCACT
TTATTGGCCGGTTGGGCAAATTCGAGAGCAACAAACAAGCCACGCCGGATGTACCGGATACCCTACGACGAAGCACTTCGTGGTCTCAGTCCACAGGGAA
CTTGTTAAAGATGGCCTCGGACAATACGACCATCAACGTGTTGCGAATGTCGCTATTTGAGTTACACGATCGGATGAGCTACCGTTGGGTGCTGCACCCG
CAGTCACCGCTCAAGACAATGTGGGACCTCCTCAGtgctgtcatcgtcgttTACTACTCGTGGATTATCCCATTCATGTTGTGCTTTGACTGGTACGTGC
CGTCCTCGTCTACAACCATCCTAATGAAAGTGCTGGATGCGTGGGGGGTCTTAGATATCGCGTTGCGATTTCGAACGGGGTATATCGAGTATGGCGCTGT
GGTCATGAATCCGCGCAAAATCCGTCGTGCGTATATCCGCTCTTTCTGGTTCCCTATCGATTTAGCATCTTCGTTCCCCTTCGAGTACTTCATCAAGGAC
ACGTCGACCACCGTATCGACGAGAAAGACCTTCAAGATGATCAAGTATATCAAACTACCCCGGTTGCTTCGACTGGGGCGTTTTGTCAAGTATCTGAAGC
GATACAAGCGATATTCGAGCATCACCATCGCGTTGAATGGTATGATCTTCTCGGGTCACGTAGCTGGCTGCTTGTGGGTGGCCATATTGAAGCCATGCGC
TGATGTTATTGAAGCTACCCGATCGCACTGCCAGGATGGTGGAGAGATGGATGTGTATTGGGTCGCCTTTCACCACGGGATAGTGTCCTTGCTCGGTGTG
TCTGCTACACACGTTGAAGCTAGCGATCGCTTTCTGAGCGGTGGATACAACCACATCGCTAGTGACGACCTAAACAGCGTCATTTATCTGTGGTCAAGCG
CGGTATCACTTTATGGCGCCATTTTGACAGCTATCCTCTTCGGCACTATCATCGGACTTGTGCAGAGGTATCTTTGACAAAAACCTGCTTCAGATATCAC
TACAACAGCTCTAACCATTGCACTTTTTACAATTTTTTGTAGTTGGAACAGGGCCGAGAACGCATTTCGGAAGAAAATGGACCACGTCACGCACGAAATG
GACGCGTTGAGTTTGCCGAAGCCATTGCGAGTGAGTGGCTCTGAGATTTCATTTGTTTGTCTCGAGTCGCTGACCTTATACTTTGTGGCACAGGCTCGAG
TGACGGCGTATTATGACTATCTGTGGCTAAATGTACGCTCATCTGTTATACTTCCGCTGCTTTTGTAGACTAACACTAGCCGTAACGCCGCAGAATCGTG
CTTTGTCGGAGCAACTGAATTTACTGCATGATTCCGGCATGTCGTTGACGTTGCGTCGGCAAATTGCTATTTACCTATTCAAGGACAATCTACAGAAGAT
TCCGTTCTTCCAACTTGCCACCGACGCCATATTGGGCATGATCTGCATGCAGTTGCACCAGGTCATTTACATGCCGGACGATTTTATCATCCAAGAAGGC
GAGATTGGCAAGGAATTGTTCATGATCGTGAAAGGAATCGTCCGAGTGCTGCCACCAAACGGCTGCAAGAAACCAGAAAACGAGACGATCATCTTGCTAA
GCGAAGGCGACTTTTTCGGCGAGATTGGCGTAGTTATGGAGGTCGAGCGCACTCGCAGCGTCAAAGCCGAATGCATGGCCGAGCTCTGCGTTCTTGCTCG
AGAAGGTTTTGACAAAATCCTGGTCGAATTCCCAGAGTTCGCGAACGCTATGAAGAAATTAATTGTGCAGCGCGTAGGCCAAATGTGGAAGGATGACGGT
CCTGAAcgcatggagaagatgacggcCCTCGCcgacgccaagatgaagaaaacgATCCAAGCATACAAGAACATGGACAAGCTGCGCAG