Description :
From Genome Similarity Track
Location :
Scaffold_994:523- 3414
Sequence
2891 bases(100 bases per row)
TCGTCGCTACTGGATGGACATAAATTCCCGCCGGCATCATCAAGCATTTCCCCTAACGGGGAGGCAGAAGTGTTATTATTCGCTCCATTTTGTGGATTGT
TTACGAAAGTCTCGGTTGATGAAGTAGATCTTTCACGATTAAGTTGTGACTGATATTGACTTGAGCATCAGATAAGTGCAGTGCGTCGAATTGTTTTGCT
TCGAGCATAGTACACACACACTTGAGTGCCTCTAAAGCTTCGGTATACTCGGCCATGCCTAAATCACTCATGTTACTAGCGATGGTGTTGATAACATTCT
GAGCTTCTCGAAATTTGCCATTTGAATCCCAAGAAGTTGTGTCTGATCTGGAAACAATCCTGCCAATTCGGAATGGAGTTTCTGGAAGAGGATTGCTCGA
TGACGAGCAATGGAGTGTCGACAGTAACCAACGTGAGTGCCATAACTTTGCTGGAATAATTGTGTCTAGTTTCATATTCTTGCGTACAAAAAATATGTGG
CGGCACGGCAAAAGTCTCGTCATCATGAACAGGCAGGAGCACTGCCAGGTTGCTTTCCGAATTGAATACTCCGTGTTTGGTTCATATAAAGTGTCGCTTT
TTTGCTCAGTGCTCATGATGAAAAGAACACCAGGGAATGCTTCGTAGTATCTGTAGGAGGCTCAGTTTAGAGCATAGTCGTACTGCTGAAAGATTAGCTC
ACATACATGCTCACTAACCAAATTAGCGATGACAGGCATTTCTGCATCGTATCCACTGTGGTGAACAACAGTCAACTTGTGTACCAGGCTATCTAAATGC
TCCGCACGCGATTGGTACATCATGACAGCTGCAACACATTCATCGAGGCCCATACTCGAGTTCACCACATCTTTAATTTGTTTCCAGGACGCCTTCAGTC
TGTTGTTCGTGTTATTTCCTAACGTGACCGCATTTTGTCGGGTGTAGGAACACCACAGGTCTCTACAGTTGTCCCAGTTTCGCAAGAAATAACGTTCGAA
CGGATGAAATTGGGTGGAatccagttcttcttctccagtcGTATTATTTCCACAGCTCGTCAAGAAATTTCCACACCCTATCTCAGTCACATGTTTCAGG
TACCTTCGATGCTTCTCGTACTCTTGTTCACTCTTGGCATAGACCAATAGACGTACGACATCCCgcaattgctgcttctggcaAGTATTAAAACAGTAAG
TGCTGCTAGCAATATCCTCGCTGAGGTACTTAATCACATGAACTGGCATAAAAGTATTCGTGCATCCGGAAGTGacatcttcaacaccgaCAATTCAGTG
AGATCTTTATCAATAATCACACTGGATTCGAGACCAAGCAGGGTTGCTCAtcttgaactcctccattGCGGTGTGCACAGTTCCGAGCGCTCGTTCTTAA
GCAGTGCATGCTGAACAAACTGTCCTTTACCGAATACGTCGTGCGCCATAAAAGAAAACACCTTGAACTTAGATTCGTTTGTGCCATGGGTAGCATCTAT
CAAAAGGACCTCGGAGAACCGTGAAAACATATCCCTCATCCACTGCGTCTGCATCGTCAAGCACGTTGCAGCTTTCTGCGTGAAGCAGGTAAAAAGAAAA
ACGTTAGCAAAAACTTACAAGAACAGCACTCATAGTTTACATACCTTGTTGTTGACTGTCTCAGTAAAAATTCTAGCAATATTTCCAGGCTGCTCGCTGA
ACTCcttcatccagcgcttcAATCTTTCCACTCTGGTTGTGTTCGCAAACGCTTTATCCTTCAAGGTCCGGATCAAATTATGAACATCCCGGTTCGTCGG
AATGCAGTTGGAGTTCTCAAGAATGTACTGATGAATAGTTTTTTTCTTGGCCCCAGCTTTTTGTAAAATGTCACCTGTCTGCACGACTTCAGAAGGGATC
GCGAGTCTGGTTTGAGGATAGCTGTCGAACGTCTTCTTGTTTAGAGTGTGGTTATGGTTTAAAACGGTCTTGGTAATGCACACCATCCACTGTGGATTAT
CCTTCCCCACAAGCTGGACGCATGCATTAATCTGCAAACACCAAACACAGATGTTGGAGTTGTTAGTTGCAAGAAGCGGCAGTCTGAAACACTAATCCAG
ACTAGAGTTCCAGAAAGGGATATGCAGTTCCAGACTAACAAAATCTTACCTGAACCGGACATCCAATCCGACAGCTTCCCTGACACTGGCGCTAGCCTTC
ACCTCTAGCCTTGTACCTTCCAGCGTGCGTGCACTCAAGGGCCTTCGAATACTGCTCCAACGACTCCGGAATTAGACGGGCTGGGTTCTTCACCTTGGTA
TTGCGTGCAGCCACCGTCTTGTTCGTCCTCGACCGAAAACGCTGCATAAAGGCTTTTAAGTTAGCTAAAGTAGTACCGCTGGAGCAAGCGCTGCTAATAC
ACACCTGGTATGTTGTTGCCTGATACGCCTCCACGTACGACTGAAATTCCTCCCAGGAGGTAAAGTGTTTTCTTCCCAGTTCTGGGGCGGTATCACCAGA
CCCTTCTACatgcaatgcagcagcaaggtggCCACTGCCATCCGTAGGTAGTGTAGGCGCCCGTGAAGCCGCCGACATTTCGTTAGGTTGAATCTGCTCT
CCCTGAAAATGCGTAGACTCGCCTTGACACGAAAtatcgtcgtcactgctgccTCGTAAAAATTGCACGGACCCGGCAAACTCATTTCCCCACGCGGtct
cgtcttcactgctcTCGTGAATACTTGAGCTGTCGCCACTACCTGTATCACACGCTGAACGCTTTCTCTTCCCCCCCCCACGCTTGCCATCTTGATCGCC
GTCCAAGAATGTAACCTCGCTTCTTGCTTTTGTGCTCCTGCAGTCCAGAGGTTCGTTTCGACTAGGGTATAGCGTATAGCGTATACCGTAT