Description :
From Genome Similarity Track
Location :
Scaffold_6:522974- 525151
Transcript NameFunction/comments
Phyin_T30-4PITG_04509Putative uncharacterized protein

Sequence
2177 bases(100 bases per row)
GAGCTCGTAGCAACCCAGCGGGATGACAGCAGCAGGTGAGAACCGAGCAATTGTGTCAATCGCTTGTCGCGCCAGCTCCCCATTCTTCTCGCTATAGCAC
GCATGGAGAAGCAAGTACAAGTTGGGGACTGTGCTGCAGATTCTCTCTAGCTGGTGCTCATCGTTCTCAAAAAGCCGCACAATCTTCTTCGACTGCTTCA
AAGCAGCCAGGGAGCGGAGATAACACGAGTATACGGCGCGTGGTAACTGTGTCACGTTCTCGATCGGTACCCTTTTCTCCTTTTCTTTCGATTCAGCTTC
ACCTTTTTTGTCTCCGTCACAAACATCATTGTCCGCTACCTTGGCTGCTTGGCGAAGCTGATGTTCCTGCAGCCACACTCTTCGGTCACGGTCGTAGGAC
TCGAAGAACGCCACCGCCAGTTTGTGTTCGTTCAATTGGTGGAAAGCTTTCACCAGATTACCGACCATCAGTGCCTCATTGGCCACCACAACATCCACGT
CTTGATCGGGACCCGTGGAGCCCACAAACATCGCGCGTGTAGAGATGTCGACCGAAAGCTGCGCAAAGATGTCGGCAGGCACAATCTGCAAAAGCCAAGT
CCGGTCGTCGCCCACGTCCTCCGTAGTCGCCAGGCGCACTTGAAGCGGTTTTTCCTTGTCCACCACAAAGGGTCGACACTGCGAAATGACCTGCCAAGTG
TCCAGCAGTTGCGTAGACGACGGCACATGCTTGATTTCTAGTGAGAAACGGCCGAGCGCGTGGGCTGCAGCTTTTCGCTCTCTTGGGTCTAGCGAACGTT
TAAATGCTGGCAAAGAGATGTCTGCGGGAGGGTGAGGCCTCAGTACACGCTTAGCAACTACTCGGTTGGCAGGCGTTGTAGATGATGTTGGTGTGTGTCT
GCTTCTGGGGGGCTGCGTCTGCTGCTGTCTCGATGTCGGAGGGCTCTCGAAGTTGGCATTGGGACCCAGACCCAACCACGCGACGAAATCGGAGGCGCGG
CTCCAGATCAATCGCTGCGATTGGTGCTGCGGTACTCGAGCACGTCTCAGGTTCAGCATTGTTGAATCAAAATTGGTGGTGTGTGGATCCCGCAAATGTT
TCAAATTACCGGTATAGGATTTGTTCGAAAATCTCGACAACTCGAGAAAACAAGCGAACTTTAGAACAACCCACCGCATCAGTGCCTCAGGGTTGGCACT
GTCATCGTGGCATAAAGAGGAAGACTTATTATCACGTCTCGTGCTGTGCGTTCTGTTGCCCCTGGTGGCCACTGTCACGTCAAATTTCCCTGTTTGCAAG
CACCAATTACGGTGGTTAAAATTTGGGTTGCTAGCTGACCGCCAACATAGAGTAAGAGATCATGGACGTCTGGAATTTGCAGCGCAAGCGACCGAGACCG
TGGCACTCCCTTATCCGGTTGCAAATTGCACCCACTCGCTCTCTCAATTTTCGATGAAATGAGCTCTTGCATAACTATTATACAGAGTAAACACAGTAGT
CGTTGGAGCAATAAACAGCATTTACCAATTTCTCAAAACACGTAAAAAGTCGATCCACTTCACAAACGTTACACAAAGTATATTTCGTTCAGATGAAAAA
GATGGTGCTCTGTATTCCTCTTCGTATTTGGAAGAACAAGCAGCAAGCAGCCAAGAAATACCCGCCTCTCCTCGTCCCTTTTCGGATAGAGCTGATGGTC
ATTTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAAT
TTAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGAGGTTAATACAAACTATCAGTTACCTATAGA
AATGCAATGTCATTTAACCAATGGTTGGTTTTGAATGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTG
TCACACTTCATGTAACCAGGGTACACTTAGTGCTACGTACCCCGTTACATCATTGCATAAGCTCTCATTAATGTATTTGTTCGTGTGACCCCTAAAGACT
GTGGTAAGTGCTGATCAATCGGTCATAGCGAAAGCTGCGTATGTCGGATTGTCTTAAAGTTTTGACCATAAGCTAAA