Description :
From Genome Similarity Track
Location :
scaffold_42:522823- 531736
Transcript NameFunction/comments
g11348.t1 putative GPI anchor protein
g11349.t1 hypothetical protein PHYSODRAFT_553148

Sequence
8913 bases(100 bases per row)
CTCCTATTGCCACGACCGAAGCTCCGGTTGCCACGACTGAGACCCCTGCTGCTATGACCGAAGCTCCGGTTGCCACCACGGCCACGCCTACGGTCACGAC
CGCTACTGTTGCCTCGGATGCCGATTACAGTGCCGGCGTTGTGGCCACCGATTCGTCCTCCTCGACCAGCACTTCGACGTCGACCAGCACCACGGCGACT
ATCTCGAGCGGTTCCACCACCACCACGTCGAGCGCCTCGACTAGCACCACCACGTCCAGCGGCTCCACGGGAGACTTTTCGAGTGCCACCATCAGCTCTA
GTTTCGAGTATAGCGGCACCAACGCTGGTTCGGCTGCGGGCACGTACGGCAAGGTGACGGAGATGTCCTTCTGCACCACTGAAGACGTGTCTCTGACTGA
CCCTGTTGGCCCCATGAGCGAGGAGGTGACGATGGTCTTCCGTGGCCCCATGAACATCTACAACATCGCCGTGTTCTCTGGGTCATCCGGCAGCGACTGG
AGCAAACTGTCGTCGTACGACGCCGACGCCGGCACGCAGTCCAACATGGTGTTCATGAACAACCTCAACATCGACTACACTGGTGCTGACTCGAGCCCGC
AGGGTTACTCGACGGCTGACGGTACTGCCACGGCTACCGAGTCGACCATTTTCGGCGGTTCCCTTGCGGATGCCTCCGACGCGTCGGTGACCGGCGGTGG
TCCGTGCGTATCCACCGGTTGTGAAGTTAACATCATGACTGAGACCAACTGCGCGGACGAGGACGGTTGCACCGGCTACTACGATGACATGGGCTTCCAC
GGCTGGGACGGCGGCATGAAGATGTTCGTGACCAAGGTGGAGATGCCAACCGGTTCGTCTGCCAACCTGCCTGCTATCTGGATGCTGAATGCCCAAGTCG
TGCGTGCCAGCCAATACGGCTGCAACTGCCGTGGTGAGGGCTCGGAGGGCGGCTGTGGTGAGCTTGACGTCGCTGAGGTCATCGAGACAAACACGGCCCA
GGACAAGGTGTCCACTCACTACTACTTCTACGATGGTAGCGTGTCCCCCGGTGGCGACAACTACGCCACGCGTCCGACCGACTCGGCCGTGACGTACGTG
ACCATCTACGACAACTCCGGCGAGGGCGTCGTGAAGATCATCGAGATCGGCGGCGACGACTTCGACTTCTCGGTGGACTCGGTCTCTGCTGACACCGTAT
CCACGTGGCTGTCCGCCTCCGTGGAGAACCTGCTGAGTTAAGTGGCTTGCCGACAAGTCTCGACTTTGCATTGGATGTTGGAATGAATGGGTATTGCATC
AGACCAGATAGTATCGCTCTCTGCGCGCGCTGGAGATAATACGATAGCAGTGTTATTCTAGAAAAGTGCTGGCCCGATAATAATGTATCATTCGCTGTGT
AGTGCCCGAAATAATGCGATGCTTTCATCGGTCATCATGAACTGGGAACCGTACAAGCAATACAGCTGTGTTGTCTAATGCATTTGCAGCGAGCGAGCGC
TGCCATTGTGCAGTGTGAAGCTGGTGGCACTGTATCTATCGGTGAGGAAGCTGCTTCAACTATCAGTACATCAGTTGTTGCATGCCTGTAAAGCTGCTTT
TAGTCACCGCCGTCAACGCGCGGTGATACCAGTGCAGGCACTCGCGCGTCGCTGAAGTCTATCCGCGGTGCAGGAGGAGGAGGAAGGGCAAGGCGAGAGC
AAAGCCGCGTTGAAGCCGACGGCAACGCTACGAAGCGGTGGACACAATGAGGGTCCTTCAGTCCGCCCCGTGCTCCATGGCGCGCGAAAGATTGGATCGG
CTAGACGATGGTGAAACGAATCTGTCGTGGTCGTCGCTGTCGGCCAGCAGTTTGCAGCAGCGGTTTGCAGCTCCCTGCAAGGGATTGAACTCTACTGGAC
ACCAATTCCTGCAGCTCTCGGTTCGCAGTCATCAATGCACCCAGAAGACGTTGGGCTGTCGCCACTGGGGTACGGGCGCACGAACAACAGCCTACTGGCT
GAAGCATGGTGCGCTCGCAACGCTGGCAAATCAGTCCCGCATGACATGAGACTCCTGACTCTCGTGGGATCTCTTTCGTACAGCGAGGTAGCCACACAAT
GTCGGCGCACCACTCCAAACGGATTCATGCTGATCAAGCAGAGCGCGACGCCAATTAAAGCGCGCGAGAGACTTGCAGGCGCCACAGCGTTAGCCCCATT
AGCATATAATACTTACAGCAGACACACACGCTGGCCGAATATCCGCAGGCGAATCAAGTCAAGTTCGGCATGGCGTTTTGGTGTTGCGGCGCCTACGTGT
GACTCTGGCGTAAAGTATGTGGATCGGCTGGGCACCGATTCAGCGTGGGCATACAAAAAACAAGATGTCGAAGGCAAGTCACGAGAGTGGCACCTGAACA
CGAATACCACAGCGACAGGACGACCACCCACCCCGTCTAATTTTGTCCCTTTTAATTCAATATTACAGGTAAGTGACCTCCACATTATGCAAATAGTTAC
TACGTCTGTTGAAGCCGTCATTTCTGATGTCTTCAGAATCCCTTGCCATCATGAAAAATGCTAATTCGCAGGTCAACCGCGGGCAGTCATTTCGAGACAA
CTAGTTGCACTGACGTTGCAGGGCCCGCCAGCTGGCGATGGCGTCTATGGCCCAGGGGCGACTATTGCCTGAGATAAGCGCCCGTCGTCATGAAGCTGGC
CACCTCGGCCCACGCCACGATGTGTATGGCATCCGTCTGTCTCCATTGCCGATCGAACCGATGCGGACTTATCCAGGCACACGAGTCTGCAACGCAACAC
GATCCCATTCTGCAATTTGCCGACTTGGCCTCACATCCTCCGTCCCACAATGGTTAAGGTCTTCCTCGCCCTGAGCGCCGCGCTGGTGATGGCCGCCCCC
GTGGCCGCGTCCGTGTCCGTGAGCTTCGTGAACTCGTGCTCATACGCCATCAGTCTCTACGACAACAGCAAGACCGAGAGCATCGCGGCCGGCAGTTCAA
TGAGCCGCGACTTGGCCAGCGGCTACAACGGCATGTTCCGCGACGGCACCAGCGACGAGGCCACGCTGGCCGAGTTCTCCGTCACGGGCGGCTACACGTG
GTACGACATCAGCGTCATCCCGCCCGGAAGCGGCAGCTGCTCGTCCTACGACGCGTGCAAGGAGCTCACGGGCAAGTCCGGCTACAACGTGGCCCTGAGC
ATCGCGCCCGACACGAGCTCGACCAAGTCCGTCTCGAGCTCCTGCGCCACGCTCACGTGTGAGAGCGAGGAGTGCTCCGACGCCTACCTGTACCCATCGG
ACGACAGCAAGACCCACAGCTGCCCGGACACGCTGCCCTTCACGGTGACCTTCTGCCCTGGCGGCTCAAGCTCCAGCACAACCACAACCACAACCACGTC
GTCGTCTGCGGCGCAACAGTCGAGTCAGTCGACCACCACGTCGGCCCCTACCGCCACGACCGCCACCCCGGAGGTGCAGAGCGACTACAAGTCGGGCACC
GTCATCACGTCGTCGGGTAGCACCACGACGGCTCCGACCAGCACCACGGCAGCTCCGACCACGGCTCCGTCGACCAGTCAGACCCAAACGCAGACGTCGA
CTTCGACCACTTCCACGTCGACGACCACGACGTCGACCGGCACCGCCGCGTCGTTCTCGAGCGCGACCATCAGCTCCAGCTTCGCGTACACCGGCACTGA
TGCCGGTTCGGCTGCTGGCACGTACGGCAAGGTGACGGAGATGTCCTCCTGCACTACGGAGGACGTGTCTCTGACCGACCCCGTCGGCCCAATGAGCGAG
GAGGTGAGTTTGGTCTTCCGTGGGCCCATGAGCATCTACAACATCGCCGTGTTCAACGCCAGCTCTGGCAGCGACTGGAGCAAGGTGTCGGCCTACAGCC
AGAACGGCACGCAGGACAACATGGTGTTCATGAACAACCTCAACATCGATTACACTGGTGCCGACTCGAGTCCTCAGGGCTACGCGACGGACGACGGCTC
TGGGACTGCCACGAGCTCCACGGCGTTCGGCGGTTCCCTCGCCGACGCGTCGGACTCGTCGGTGACTGGTGGCGGTCCGTGCGTGTCCACGGGTTGTGAA
GTCAACATCATGACTGAGACCAACTGCGCCGATGAAGATGGCTGCATTGGTTACTACGACGACATGGGCTTCCACGGCTGGGACGGCGGCATGAAGATGT
TCGTGACCAAGGTGCAGATGCCCACGGGCGATTCCGTGAACCGCCCGGCCATTTGGATGCTGAACGCGCAGGTTGTGCGTGCGAACCAGTACGGCTGCAA
CTGCCGTGGCGAGGGCGCGGAGGGCGGCTGCGGTGAGCTTGACATCGCCGAGGTCATTGAGACCAACACGGACAAGGACAAGGTCTCGACCCACTATTAC
TTCTACGACGGCAGCGTGTCTGCGGGCGGTGACAACTACGCCTCGCGCCCCACCGACTCGGCTGTGACGTACGTGACCATCATCGACAACTCCAGCGATG
GTTCCATCAAGATCATCGAGCTGGGCGGCGACGACTTTGACTTTGACGTGGACGCCGTGACGGCCGACCAGGTGACGTCGTGGTTGTCCGCTTCCGTCGA
GAACCTGCTGAGCTAAGCAGCTCCGAAGTGTCTGGCATCTGTAGCCGCGTAAGCTGAGCTCTGTGGTGTGTTTGCAGTGCCGTGGCATGGCCCCTCGCTG
GTTGCGACTAATAGATGAGGCGGTCATTGCTGTGTCTCTCTTTCGCTAGAAGCTCGCACGTAACTTGATATCTATACAACGAGATTTTGACTACTCTCTT
CGAATCACATCAACCGCACAATGATTGAGCCCCTTTGCTGCGGTAGTCGTAGTTTCTAGTACCGTTTGCGTTGTCTTGCACTCTGTGGTCGGTGCTTCGC
TATCGGATACCGGTGTAGCAAAAGGGATGGTACTTCTAAGCGTCCGCCGCACCTGGTATCGTCCCCACACCAAAGTTATTTGATGATAGTGCTGATTGAG
CAGCCTTGCCAGGCGTGTAACCCGTTATCTCCTTGTACTGCTTCACCGTCGCCAATGCGCGATCGCCGTTCACCGAATCGAACAGACCACTCGTATCCAC
GACGTTGGCCGAACAAGCTCGGCCCAGCGACGCACTACAGTCGTCCGCCGTCGAAATACTCGCCTTGGCTGGTTCGGCCAGCATGGGTTCCGCCGTGTCT
TCGAAGAAGTTACGCACAACCATGCAAAGATTATTCCCCGAAGGGCGTCCTATAGGTATTTAGCTTACAGAGTCTGAAAGGGTTCATGCCTGAGCCGGCT
ATCACCATGCAACCTTCCCCACCTCCAGATAGGCACACGGCGACACAAGGAAGCTTTTCTGCTTACGTCTTGTCTTGAAGAAAACTTGGACGGTGCGCAG
TTTCGTCATGCAGGTCGCGTGACGTGACATCCGTTGAGCAGCTCTCGAGTCGACGCAGCATTCTCCTCCAGCCTTACGTCCGCGCTGGGAGGTCCACCAA
GAATTACATTTTTAAATGTGGCGGGTAGCTCCTCAGCAGCGAACAGCGGGCTGTCGGGACTCCTTTAGCAATCTTCTTCCTCCTCCGCATCCTCGCCTCC
CGCGGAGGACGGCGCTTGTGCGGACGAGTGCGCTTGACGGAGCGAAATGAAAAGTGAGAGCTTGCTGCAGCAGTGAAGTACCCAACAACACCGTCGAGAA
CACCGTCGAATTGGATGCAGGCGCTGGGATCATGACAACAATGTTGGAGTGCGTACATGCAGCAGGACAATGCGTGCGGCCAGCAATGGTTAGACTTGAC
AGAACTGCACCATGTCTGGACTGGGCAGCAGCTCTCACTTTTGATTTTGATCAATACATTTCGGCAAGAAACCCTCGGGAGCAGGGCCAGCTCCCCTCGC
TAGTGTTTTACACTTGCCTACACTGTGAAATATACGAGAGTTCATCAAACAATAGCCGACATTCACGTCAGACTTGTCGTACCCTCCGACATCGGTGAAT
GAGTCTATTTGAAATTCCTGGTAGACTCTGAAGTAATTTTCAGAAAACATTATAATATTTTAAAAACAGCAGTTTCGCTCCATCCTAAAGTTACTTTACT
AAAATGTAATATCAGTACTATCTCATTTGTTTTTGACTCGAATGAGAGGCTACGTAGTTGCTAATGACCATAGTGGAGGTCACCCCACGAGTGAATGGTA
CATTACATAGGACCACTTGAGCAATTTTCCGTACCTTGCGCTCAGTTAGTAGCACAAGGCCACCAACAGACTTGTCCACCTTAAACCACGGTAAGTTTGC
TCATTCTCCACGCCCTTCATTAAGTGCAATAGCCTCTGTTGTTCGGCGTATGAAGTGAGCCAACCCACCTGCTCGTACGCCAAGCTGACTGTGACGACCC
GTGTGTGGCCTGTGGCCGTGACGTCCTTCACTTTTGCAGTAATGAGCTGGATGACTTCAGTTGTTCGTGTCTGTATTGCCCGTGGTGGCGATATGTTCTG
CTAGTGGCACCCGTACTTTCGGCTTATCGTGATCAAAGAGTCTTGTGGAGGAGGCGCGCTAGAAGAGAGGTGTCGCCCCCCGCGGTTCGGGCAGGCGGAA
GCTTCTAGAAGCTTCCACAGCTGCCGTACGTCTGCCTACTTGTATTCACGTATGTTTACTATATCATACTAAACTTTAATGTCTGCACTACTGTTTCAAA
TCGGCTAGCACCCACCCTTCTATCTGACCGCGCGCCCCTCTGGCTTCAGCATTTCCCCATTGAGATCGCTTCGCGTCGTCGCTGCTACTGAGGATTCGTC
TGACCCTCCTGCCCCATGCTGCTTACCGGGCGGCCGATTCTTGAGGGCTTGAATAGGTCTCTCGGTTGACGTTGCCTTCTCCCTGCGATGCTTCGTGCTG
GAATGGCGTCGCCTCCTCGAGACGATGTGGAGCCCGCTGTGCCTGCCTCACCACCTGATACGTTTCCTGCTCAGCTGGCACTTCCCCACGCACCTGTAAA
TTCACCTGTGGTTGTTCTTGATGAAGCTGGCAACCCGGACTCAGATCTCGACGCCGATGACGCTGTGCTTTGGATTGCCATGCTTCGCAGGATTGCGATG
AAGCAAATTCTCGAGCAGCTCAAGGCTGAGAGACCAAATGAGGACCATGATAGCGAGAGGGACGGCGCTTACACCACCCACGCTATGCACCAAGCTTTGC
AGAAGCACTTAAACAGCTTGTGTTCATGAACAAGAGATTCAAGTACAAGAGCGACAAGCTTGTCAAGAATGCCATCAGGTGCAAGAAGTATGCTCTCTTC
ATTATTGGGCGGCGCCCTGGACAGCAGGAGGGTTCTTGGCATTGTATTGACAGAGCCACTGTCGGTAAGAAAAACCTCTTCATTGAGTCCGACAGCTACA
TGTATTTTCCTAATACTGTAGAGAAGCTTAGCTCATACTTTGAGCACGTTGTCGGCGTGTACGTTATCGAGGATATTGTGCAGTACGGAGTACCCAATAA
CTGGTACAATATATTTCCTTTCACTTGATTGCTTGTTTAAATACTCTTGATTATTGCAATTAATGTAGTGTGGTTAACATGAAACGATGAGTGATTGCAC
ATAATTATTACGCCAATTTTTGTAGAAGGGTTAATACCTTTTTAGAAAGGCCATTACGCAGGCGTAGAAAAGTCGGCTTTGCAGGTGACTTGGCGAATAT
ATCTTCCACCATTTCCTTAGTGCTACAATATTTCATCTTCGCTCTACATTTTCTTGTACGAAGCAGTAGCGAATAAGGATATGATTGCTTCTATCATGAA
GTTCTGGATTATATGAGAGTTTAATACAGCTCTGGTTGTCGTCGTAGAGAGTGATGACATGTGGGCTACTGTGGTCTAGCACTATCAGTAGGAGTTTTGA
GAAGATGACTTCCTGCATGCAGTGGCATAGTGCGACGTATTCTGCTTCAGTTGTGGATAGCACGACTGTGTGGTGTTTCCTAGACTGCCATGAGATTGGA
TTGCCACTTATGTAGGTAATATGTCCTCCTACATATCGACATTTTTCGGCGCAGTTATCATAGTCTGCATCAGAAAAAGCTGTGAAGTAGCGCTTTGTGT
TATATTGCTCCAGGTTTTCCTTTCCTCCAAGGATAATGCCGAGGTTGCGTGTACTATTTAGGTATCCACGGCTTCTCTAAACCGCATTTCAGTGTTGTTT
TCCTGGATTAGCCAGAAATTGATTAGCTTCACGTAGAAAATAGGCTAGGTCTGCCCATCACCAGGTACATGAAGCTACCAACCGCCTTTCTGTACGGAAT
CGCCTTCATCTCATCGTGTTCCAAAGGAGTTTGTGGGCACATATCTAGAGAGAGTTTGATAGTCAGATCAGTGGGTGTTTCCACTGGATATGAGTTTAGA
TGGGAGAAGCGGTCCAGGACTTTGGTAGCGTATTTCTCTAGGTAGATGGAGCGATTTTTTACGATCGCGTACAATGGACCACCCTAAGAGGTAATGGGCT
TCACCCAGGTTGGACATTTTGAAGCGCTGTTTGAGTGCGTCCTTGATATAAGTGACAATGTCGACTGTGGGTGCAATGATGAGAAGGTCGTACGTGAAGG
AATGTAACATGTCTATCCGTCATTTTCCCCTACAAAGATGCTACTTCATCGTAGCTAAGTTGTCAAGTGCCAGATTCGAGGGGCTTGTTTAAGGCCGGAT
AGACTCTTCACCAGATCGCATACGAAGTGTTCTTCACATCGGCGAAAGAACCATTCAGGTTGTTCCAGGCATATTTCCTCATCTTATGGAGCAGCGATGG
TAAGAAGCAGTCGTAGGACTTCCATGTGGATGGCAGGGGAGGAAATCTCGTCGTAGTCAATCCCTATCTTAGAAGGAAACCCTTAATAACTAGGCGAGCT
TTGTAGCGATCTA