Description :
From Genome Similarity Track
Location :
Scaffold_692:5226- 6872
Sequence
1646 bases(100 bases per row)
TACCTCCAGATAGATGTGTCCGTCATGAAATTGACTTAGTTCCTGGGACGAAATACTGTGTCACGACAGCGGCCCTTGCCCAAGGAGCAAGGTGATGTCA
TTGATGACTTCTTCCGTGCTAAGCACGAGGCGGGAATGGTACGTGAGAGTAAATCTCCACATTCCACACCCACATTTTGTGTCGTAAAGCCGAACGGCGA
GTGGGGTATTGTGCATGCCTATAACAAGCTTTATGCCGCTACGATTCCGGCACAGACACCCATTCCTCGAAAAGATGTTCTTCAAAACAACATGGTTGGT
TGTACTATGTATAGCGCACTCGACTTGGTCGATTGATATTATAAATTGCTTATGCAAGCGAGTGATATTCTGCTTACATCAGTGAGTCTCCGAGTGGTAT
GCTATGGGAATGGCTGGTGATGCCCCAAGGTCTGTCTAAATCTTCGGCAACATTTAATCGTCTGGTGGCGCAACTTTTCCGCCCACATCGGGATTACGCA
AGGACGTACTTTGATGACATTTTTGTCCATAGTCGTGGCGAAAAAGGTCGGTCTGACGTTGAAAATCACATCAGTCATTTTCGAGCTGTGCTCGAGTGCA
TACGCACTAACAAACTGTACGCCAACGCGTCTAAATACATTTTGGGTGCAGAGGAGATTCCTTTTGTAGGATGTTTCATTGGTAAGCACGGCCTTAGAGC
GGATCCCGCTAAGGTCAAGGCTATAGTGGACTGGCCGATTCCTAAGAATAAAAGAAGACTTGCGTTAGTGGCTTGGCCTTGCCAAAACTTAAACAAGTAC
AGTGAAATTTACGTTGATATGGCTCGGCCATTAACTGGTCTCCTTAAGAAGGACACAGAATGGCGCTGGGGAAAGAACCATGATGACGCATTTCGGGCAA
TAATTGAGAGTTTCGCCATGTTTCCATTTTGGCGTTTCCAAATACATGGTACCCTTTTGTTGTTGTCTGCAATGCATTCAATTTTGCTATAGGCAGCGCC
CTGTTACAAACAGATGATGCAGTCTGCGAACGAGTTATCGCATTTGAATCTCGTCAGCTGAAAGCTGCTAAAAAGAATTATCCAGTTAATGACAAAACGC
TACTTGCTATGAAGTACACACTCGTCAAATTTAGAGTCCATCTTCTTGGCTCCAAACAATTCGTCGTCTATAGGGATCATGCGTCATTACGCACGGCGAC
ACAGCCGCCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTCATTCTTTGCGGTTATAACTTCGAGGAGAAGTATAAGCCAGGCAAATAAATGTGTTGGC
AGATGCCCTCTCTCGTAGACCTGATTATGAGCTTGCTCATTTCACGACTTTGTCGTCTCCTATTGAGGACTTAATTCGTGTGGCATATCCACGGGATTCT
CAATGTGTGGCATTTTTTCATGCCCTTGGTAGTGAGGAATACAAGGACTTGGACAGTAAGTTATCGGCACGCTTGCGGGCCAGCCTACATCGATATTCCA
TCAATACTGGTCTCTTGTGCTATCGCACAGATGTAGCGGATACCGCCCGCATTGTTGTGCCTCACAATGAGTATTTAAAGTATCGAATCCTCTTCAAGGC
CCACGATACTGGCATCAGTGAGCATTTGGACCGGGAAAAGACTTAT