Description :
From Genome Similarity Track
Location :
Scaffold_504:5226- 6586
Transcript NameFunction/comments
Albla_Nc14135090
Albla_Nc14135100conserved hypothetical protein

Sequence
1360 bases(100 bases per row)
AGAATGGCACGTCGGGGTACAAAAGGAAATGTCATGGGAAGCAGCGATGTGCTAACGATAGATCAACTACGTCATCAAGATGATTGGGTGCTTGACACGG
AGCGATATCGATGTCATGTTTGCACTAGAAATTTCACACGTTTTCGAAGAAAACATCATTGTCGAAAGGTACGCCATTTATATCTCTCAACTTATGAGTA
AATTGAACCCAGTGTTTCTCTAGTGTGGCGAAGTAGTATGTGGCAACTGTACATTAAAAAAGGAAGCAGAACTGCCCGTCATTGGTCGATCGTTAGTCCG
TGTTTGTATGTCATGCATCCTATCGCATGCGAGTAATCAAGCGAATCCACAAGCTCCTCCAGTCACAACGTCTTCTGAGTCCACCCCACCCCCAAGCGAA
GACCGATGGGACGCACGGAATTTTCAATCTCCCATAGCAGACTCTGAAGATCTTACTCAAGTCACACGCGAGTTCCCTCGCTCTGAATTTGAGTATCCAT
TAGACTTTACGTGGGATCATCCATGGCCGAAACCTCCCATGGTGATTGGAGAACCTGAAAGACTTGATGTCTTGCGTAGTTTTGATATCATGGACACTCC
AAGCGAAGACGTTTTTGATATTATTTGTGATCTTGCAAGTAACGCTCTGAAAAGTCCCATAGCAGCTGTCAGTTTAATTGATGAAGATCGAGAATGGTTC
AAAGCTAGTGTTGGTTTGGCACAAAATGAAGTACCTCGATCCGTGTCATTTGGTGCACACGCAATCATGTCGAAGGAACCGATGGTCGTGATGGATACCT
TGACCGATAAGAGATTTGCAAAGAATCCTCTGGTTACCGGTGCAGCAAAGATCAGGTTTTATGCAGGAGCACCCATTTGCACACCTTCGGGACATGTTTT
GGGTACAGTGTTTGTATTTGATACACAACCTCGCAATTCTTGCGATATTGCGACATTGGAGAAATTGTCAAATGTAGCCATGAAGAATTTAGAGGATCGT
AAAAATGAAGTAGCAGCCCCCGTTGAACAGATGCATAAAGGCAATCCACGACCTGTTGAAGCACTTCGCACATCCAATATTGCTCTAGAAAATCAAGTAG
TTTCCTCCGTAGCGCCACCTGCACCAACACACACACAAGAGATTGTTGCAACGGGCGCGATGGGCGATGGTCAAGTTACCACGGGTCCAAAGATGGAGAC
AATGCTGATGGATCTTCTCTGTCGAACAACAGAAACACAACAGCAGCTCGCGACACAGCAAGGCGCTATGTTCCATACATTAGGTCAGCATACCGCTGAT
ATTGATAAATTGGCGACTGCAATGGCCCGAATGGAAGCAAAGCTAGATGCTCTCACTGAG