Description :
From Genome Similarity Track
Location :
contig_5:522550- 533151
Transcript NameFunction/comments
g1381.t1hypothetical protein
g1382.t1hypothetical protein AM588_10009353
g1383.t1Translation initiation factor SUI1

Sequence
10601 bases(100 bases per row)
TGATCCATTCGTCTACAAAAATGGCATCCAGCCGATGTACATTTGGGCGAGGTTCTCGTGCGATGTGGCCTCGTGGATGAGCTTGTCCACTTGGCCTTGC
ACTGAAAGTGGGAGTGTCTCGTTTTCGGGCAGGATGCTGCGATGGGAGGACGACACGAGCGGGCGGATAGCGTCGCCCAGGTTGTAGATGCCACGCAGTC
GTCGTCGATGGTCGTGAGCACAAGGCGCGTCTCTGCTTTGCTGCGCTCGCTCGAGATTTCGATACTTTTTTTGGTCGAGCCACTGCTGCTTTGAATCGCC
TTGCCACGGCGGCCCCACTCGACCAACGGATCGTGGATGAACGACTCGAGCACGCTTCGCAGCGTCTCGCTTTTCTCGAAGCAGATGTATCGTTACCTCG
CTGACCCGACGGAATACTCCTTCATAACCTGTGATTCCGAAAGCGTCAATAATGTTGGGCGTCAGACGGAATGGAACGATCTCGGGCTTTGCTAACTTGA
GTCCCTTATCGAAAAGGCAGTCGAAATCCACGTGCACGCACTCGCCAGTGGTGCAGTCGATCAAAATGTTTTCACCGTGACGGTCACCTAGACCGACAAT
GTGCCCCACCATAGACCACACGGCTGCCGACCGCGAGAATGCGAGCCGAGCCTCAAACCAGGCCGTCGGGTCGGCGAAATTATTATAAAACCACTGGTGA
AACCTCGGAGTGAACATTGGGTGCGAAAGCACCTCGCGGCGGTAGTACCGCGCCATCGCTGACGGATCTTGCGCGTACTTCTTTTGCATGTCGAGAAATT
TCTCTTTGATATGTGTCAACCGAACAGGCTGTATGTAGCCACGCTCGGTTTTGTGGATCTGACCGATAAGCTGCCGCATAGCCTTTGTATTCCGTACCCA
CTCCATCAATCCGCTCTCCTCGTTTAGACACACCACCGCGTACGTGCGCAATCGGAGCTTGCGCTTCCGGCCTTCTCGATCTTTCTGAAGAAGTTTGTTG
ATCATCGAGTTGAACTCCATCATGCGTGCATCCTTCCGAAGATCACCAGTCTTCTCGCGCTTACACAGAAACGGATACATTTGGCCATCGGTGCCCAATA
CTTCGATGCGTTTGGGCTTTTCCTTCGTCATCATCACATCAGCTTTATCACTAAATGCCTTGATGTAAACTTGAGCGTTCGATGAGAAGGCGACATGGAG
TTCATCACGAGGGGCAAGCCCCGATGCCGGCAGGATCGTAGTCAATGCCGCCTGGATTGGTACGAGAATTTTGGTTCGAATCCGGCTCAGTCGAATGTGG
ATCTTGCGCTGATTATTACCGGGGTCGTGGCCAGCGAGACTAATAAGTTCTTCAGCCATTCGCATTCCCTCCGAGAAGCTGTCTGCAATCTCCTTAAGAC
CGTTCGAAATTAACTGCTGCTGTGTGCTGGAGATGATTTCACGTGCACGACTTTTTCGCTGGCTATTCAATGATCGCGAGAGACCCAGTAGTGGCCACAT
AGCCTGTGTAGGGTAAGCCAGGAGCACCCGAATCATGATTTTCTTGACGCCGTCCACGACAACTGGGTTGGGGTGGCAAATGCGAGATATCACCTGTGGG
AAGCACACAAACCACTCATACGCCGGCAATGACTCGGTGGCTTCATCTACCACCTTGCCGATATCAGCCAGAATGTTCTGTTCAGGGCTGGGCTGGCTCA
GATGGTTCTCAATTTGCTGCATGGTCTTGTTTACTTTGTTGCTTGTTCGCCCACTGGAAGAACTGGCGTAAAGTACCTCGCCATACTCGAACCATAGCGT
CAGCAGTCGGGGAAGTGACTGGAATACAAACTTTGTTCCGTGTGTCAGCGCTTGCACATAGTTTTTCATCAAATTAATCAGGTGCGCATGAAATACCGAA
TCTAGTGCAAGATCGGCAGCCTCGTCAGTGCTCACAGACCCACTTAAAGCATCGGGGTGGCGTACACTCAGCAAGTACTCGTAGTATTTAGCCAGAAAAA
AGTAACCTTTCTCCCACGTGGGATCGAAGTGAATGACAGCTTGATACCGCTCGATCACCTTTTTGCCTTGACGCTGGCCAGACTCTTGCATCCAGTTGGT
CGCCAACAGTAGGTTCTTCGCGCTTAAATGAGGGTCTTCAACGTCAAAGTCCAACGTAGATGCATCAATATCAACTGGCTCGAGAATTTGCAAAGCCTCG
TACATTCGGTCCTGGCTCACCAGCAGCTTGGCTTTTTCAATCAGTGCGTACTGGTTGTCCACTGCTTCAGCATGCATCAACGCGCTGGTGGCGGTGCGAA
TAAACCCTTCTTTTCTAGCTAACTTCGCGTACAGAAGCCAGTTCTCGGATACTTCATTTCGTAGGTCTGCCTCATGCAGAATTACTCGGCGAAGTGCGAG
TATCGGATCACGGTATTTGAGCGGTGTTGCGATGGCATCATACCGCATTTTCCAAGGCGTTTGCTTTTTCCACAGAAGACTGCGCTGCCCTAGTTCGTCA
TACTCCTTCATATTTTTTAGAAATATAAATCCCTGTTCAGCCTCGTGCAGGAAGTGGAGCTGATGAAGAAATGGATACGCGCGTTGGTATGATTCTGCGG
ACGCCGCGGCGAGTGGTGCCATCACTTCCAGTCGTGCTGCTTCCAGGTGGCGTTGGAAATCATCTTGCTTTCCGCTATGTAAACTGTGGAGAACGCGCAC
GAGCATCAGTTGTGAGACAGCGAAACCCTTCAGCCGCCCCCATCAGACGAACTGGTCGACGAAACAAGTAGCGGATTCTGTTTCTCCGCACTCAGCAGAT
CTGTAAGAAGCTCCCATCGTGACAGGCGCCAAGAGCATTCAAGCGCAAAAGGGTACATCGTCGCCATGAATTGAGGTTCTTGTGTAACAATCCCGTTGAT
GTGCTGCAACGCGCTTTCAAGTCGCCCTAGCTGGATGAGACAGCCAATCATTCCAGAATAGAGCTTAGGCTTCAGCGTATCTGGGTCCTTGTGTGCGTTT
GCTTCCAACATCTCCGCAGGAGGCTGCAGCATCACATGCTGGCTAAAAGACAGTCGAGTCGGTCTAGACGATAGAGCAGACTGGATTTCTTGGATAGCTT
GTTCGTAGCAAGCTAGCGCATCTTCCCACTGAGCAAGCTGCTCGTGATCAATAATCTGATGCATCAAATCAGTGAGGTTCAGCCCCTCCTCTTGGTCCTC
GCCGTGCAGACCCCCTCCACTATCATTGCGCCGGTACGTGTCGTATAAGCGGCGCAGTGTTGTCAACCCGATAAGTGCGTCCGGTTCGTCCACGCTCTTA
TATAACTGCTGGAGATAAAACGCATTATTTGATATCAAAGACAGGTGGACCGGTCCCGCCATATCAATATTGCTGTCTCTTGACTCCGTAGGTGTAAACT
CTTGCTGTCGCAGATAAACTTCAAAATATTGGATAGCTCGGGCGTATGCCTTGATTTGGTATGCAGCGTTTGAAAGCGAGCGACTCGGAATGTCTTTTAA
AAACTCCTCCAGATACTCCTTTTCGTGGTCATCCATTTCGGAGGGCATGTCTGAACGGCCAGAAGCTGATGTCTGGCGGCTGGCAGTGCTGCCACTGAGT
GCGAGGCGCTTTTTCTCGCTGGTCCAAATCCATTCATTCAGTTCATCGATTGTCGAGAAAATGGTCTGGGAGCACTGGTCATGGCGACGAAAATATTCTC
CAACAGCATTTTCAGACGTGCTGCCGACACTAGTCACTGAGTCACTTGTGTGCTCAGATTCAGGCGGTGGTATTAGGATATCATCCATTAAAATACCGCA
GTCCTGGTCATTCAACACCGCCATAACCTCTTTTTTAAGCTCCTCGCCAACGTCAGGCCTTCCAGACCGAAGCACATTCTGTATCAAATACGGCAACAAA
AATCGGGATTTTGGGGCACGTCACGAGGGCAGTCCTACACGCCCAAAAGATCTTCCGCTCTGGCGGCTGAGAAAGGTGAATCAATCGCCGACACCACATC
AGCAGCCATTCCTCATATGACGTTCCATACGTTTCATAAAACGAAATATCATCGCATGCAGGGTGCAAGTTTCGGTCAGCACTTGCTGATAAACGACGGT
CGGATCCACTATTATCGTGACGTGAAGATTTACCGCCCGACAAAGAATAGTTTGTTGACCAATATGGCTCAACGAACTGAAGGACATCTTTCCGCTCAAA
TCGTCTTTTCATCCATTCGGGCATGGGAGACCCGGGGCCCTTCCTCGTTTTATAAGACGACCCAAACGTAGTTGTTGATGCCAAGCTTTGGCCACTATGT
TGTGGATCGGCTGTCAGCTCCCCCAAAAACTTCAGAAGCTCCTGAATTGCAAAAGCTAACGAGTCAGTGTTCTCGGGTGCTGCACGTAGTTCCTTCAGCA
ACCATGTCTCTATCAGCGCACAGGCTAAGTCCTTAGTCGAATGTTCAATCTTTTGGTTCACCTTTTCTTTCCCGACAGCAGCAGTTCCTTGCGGACCAGC
TGCCGTATAAAACATGCTTAATGGCACGCGGGCGCCATCGATTGCACCCAAGGCTCCCAAGCATCGTGCGCAAAGCAATTTTATAGGCTCATGGCTCTCC
GTTCGTGACAGCTGTAAAACAGACAGCACGACACTAGCAAGCGCGGATCGACGTATATATCTCCTTCATTCTGCATCAGGGCTTCTAACTCAGACCCACG
GACAATCAAGCATCGTAACAGTTGTGTCAACGCCATTTCACGAACCGCCATGTCAAGATGATTGACGTAGGCTGAAAGGTTCATCAGGTATTCATGTAAT
GGTCGGCATCTTGGATCGCCGTCATCCGCGTACAAGACAACGTAGATCTCATCGAGTTCGGGAATGGACGGTAGCAACGGAATCTTCGGGAACGCTGGCT
TCAGTTCAGCTCTCTTTTCGATGAACAAGTACTTGAGGACTTCCACAGCTGCTGCAATGCATTTTGTTTGAGCGTCATCTCTGCCTGAAGGTCCGACTAG
ACCAGGGTCACCATTTTTCAGATGGTCGAGAGCCTCAACATTCCAGCATTGACTAGCATTCATGGATCTGTCCTCAAGCAAAATGGCCGAGGATTCGTAT
CCAAAACACGGAAGCAGACTGACAATGATAGAGCTTAAATTCGCCTCCAGAGCTTTCGTTGACATCATTCGCAAGAAATTTCCCCATGCTTGAATTGCAT
GCACTTGCAGTTCACGTTCTGTGAGACCGACCTTTAGAGTAGCCATCACTTTAGGAACAAAAGGATCAACGACCCCGTTACTCGGCGTACTCTCAGAATA
TGCCGATCCACAATTATAAAGTTCCAGTAATCGGTCAATGCTTTTTATGGCCCGTATCTTCAATTCAACGACGGTGTTATCGCTGATGCGATTGCCTAAA
TCCGTCATGATGCCCAAAAAGTAAGGCCGAGGCATAAACCCCTCTCCAAGTTGTAAACTTGTCATTCGTTCACTCGTCTCCACACCCCGAGAAACTTCAT
TTAAGCAATTTGCCACCTCTCGTATCGCTCTCTTAGCCATACGATACTGTGAGCCGCCAAGCTCCCAAGCTAACAAGTTCATCAACCGCAGCGGGGAATG
TGTAATTACATCACGGACAGTCAAATTTTCTGGCAAGAACTTAAACAAAAATTCCCATTCTGCCAAACGATTATTGTTTGAGACTGCCTGTACCTGGTGA
ATAAGAAGGTCCTTCAGCACATACTCGAGATGATTCAAGAGAAGATTAGCAATAGTCATCGGTTGCCTCCCTTCTGAACCATTGTCAGCCATTACAACAT
CTTCCACTGTGCCGTTGTATTCATCAACGTACGCGCGCAACATCCGTTCGTTTTGATTGAGCACAAACTTCGGAAGCACGTATGGGGCACCGGCTTTCAA
AAACATTTTTGCGTCAACCTTGCCCTCCATGAATGTGCGGAGAAACAACTTAAGTGCCTGAGTCTCTAGCAACTCGTCAACAAGCGGAAAGTAGAGCAAC
TCGGGAAATTCGACGCATGATCGTCTCCATGACATCCGGTGGTGAGCCATAATGCGGCAAATCTGGTCGTAAGCAGTCGCTGCATATTTCAAGCGATTCG
CAATCTGGAACCGGTTCCACAAAGAGACCAAACGCAGGAGAATCCACGCGCAATTATCTCCGCGGTCACCTTGCTGCAAGTCACACTCACAACCAATGGT
ACCCGCCGTCAACATTGTAGCCATGATCACACTATCATCAGAGCTTTCTGCTGCTGCAGTCAAAAGAGCCTCCAGTCGCTCCATCAGACCAACAGAACCA
TCCTTTGCTGGATCAATCATTGCATCGAGAAGTCGTGGGTGCTGGACAATGGACTCCAGAATGGCTTGACGGATAAGCCCCGAGGGACTTTCAAAACCAT
TCAAAAGGAGCTCGACAAATCGCATGCCGGTTGGATCTCTTCCCAAATCAACCTCACAATGTTCAAAAATGCTGGACATCGCGTAGATTTTTACGACACG
CACGATTTCGGTAGTACTGACCGTAGCATCGCAAATTATGGGCTCGAACAGAGCTAGTGGAATGGGCAGCAAATCGAAACTGTTTGCACTGTTTCGGCAT
TGGCAGCTCTTAGGGCGGCAATTTCCAGCGCAAACTTCCCCCTTGTTGAGATGATTCACGACACCAACAGATGCTTGGCCGTACGCCACTGCACATAACA
CTGCTCCACACGTTTGAATTATTGCTGACGAAATTAATACCGACCCGTGCGTTGGATCTTGTCGCTGAGAGCTTCTACGATGCAGGTGACCATCTTTTTC
GGCGAAGTGAGCGACCCACAAACGACAAAAAACGCTAGAAGGGGGAGCATAGCAAGATAGGAACACACTGCCGTATCAAGTAACGTATCCTGCAATATTG
CCTGATAGGCAACTTTCCAGGGAAGAGCATTCCGCCAAAAATCCTCACCGGCGACATTAAGCGTCGTCGGACGTGACACACCAAGTATACCAACATTGGA
CCGCGTAGGGCTGCAGGTTTCTGGAAAAGAGCATCAAGCACAATGTCTCCGCTACGAACGCAATCGTACGAGACTTCAACTAGCCTCTCTGATGGAGGTA
TGTCGTGACAACCCGGGTGCTGCTGGTACAGTTTAAGAAGTCGACATACTCCCAACAATCAGGTGTTACAAAGGTTTTGTCCCGTTCAATACTTTGTGCA
AGTATCTGTTGGTCTCGACGGTCTCAATGACCTTGGTTAATAGATTTCGGTATTTTTCCAGCTCGTGGTCATCAAAATAGCGAAGCAAGGTTAGCCATAG
ATCCAAGTAATCGGATGTAAGCGCCGTAAGCGAGGGTGCATACGTGTTCACAACCAAATCCACACGCTGAAACAGTGTCGGAATATGGCAAAACTTTCTA
GGCGCACAAAGGCCACAATGTAGCGACGAAGAGGTAAGATGATCCGTAAGCTAGTCGAAATGGCAACAACATTTCTACGGTCTGTGCCACTTCCGATCGA
GATTAGATCGAGCACCCACCGACTCAACTTTTCATGAAGCTCACCATTGTTCTGGCGGTGCCAGCCAGACGACGGTCTTTGCTCATCCACAGATATTTCA
CTTCGCTTTCGCTTGCGAGCTATTTTGCTTGATCGAGTTGAATTGGACCCGCTGTTCGCCAGCGACTTCGAAATGAGGCGAACCACCTTTATCAACACTT
CCTTCGATGACAGCACACGATGAACACCATCAATGATGCTCGATCGAAATGATGGGCTCAACACTCTAATGTCGATGATCTTTAATAAATCCACAAACAA
TGATGAGGGGGACGAGATATTGGATTGGCGAATGTATACACACAACACCGAAAGCACCGACTTCCAAATCATTTCCGCACTAGTTTTGCTTTCACGGCCA
GCAACGTGAACTAAATGCATGTTCCCAGATACCCATGTCTCGAACGGCGGCCAGAGTACATCCGTAGCAAACGTAGAGAGGCGCGGATAAGCTTCCCCAA
TCAGTTCAAGAATCGCAGCGCTCGCTTTAAGTATCCGAGGATTAGTTTTATGAATCAAGCTGGACTTCAAGTACATCAGCGTCAGGCGAACAAACCGCCT
TTCCGAAGGTACGCTGATCTTCAACATCGTGTGAAGCAGTCGAAACGTACTTTGTATGACTTCATCGACGCTTTGACTGGAAACAGCCCCGGTCACGTAT
GTTTCCCCAGCGCTTTTCACAAGCGTTTCATTCTTGACAATGAACAATTCCACTAATTGGCATAACCTGTCAAAAGATTGATCCTCTTCAACCATCGCAT
GATGCTCACGGGCAATTCGGTCCGCTAGCACAACCACCGACTGCCGGAGAGTCACAACCATGCCGTACGAGCCAACTTGAATCGAAGGCAGCATCTGCTT
CAGCTGCTCTCTACGTTCGTAAAGATGGCTCGAATCCGTAATCGGCATACATCCACACAGCGTAGCAGTACTTTTCGCTCCCAGCGGTCCATCAGCATCT
TGGTACACATGGATCGCCGTATCCAAGTAGCACATGATGTTCGCTCCTCCAGGCAGCAGATCCGTCGCTTCTCTGTTTTTAAGCGACTCCTCCAGCAAGA
AACAGTCCTCCAGTAGCAGCACGGTGTCTCGAAAGAAGTGGATGAACCCGTACACGTCGTTTCTCTGGAGGAACAAAATCATCTGCAGCGTTACGCCGCG
AATCTCTCTCTGGGCCTGTCGCAGCCTCTCGTTCGTGTAGAACGACACCATGTAGAACAGCATCGTGGCCAGCGTCGGGTAGGTCGGGAAGCCTGACGCC
GAGGGGTCGTCGGCAGCGCGTGAAGCGCCCGTGTTGCTCTCCATGAAGAGCGTCATGGAGTGCGGACACGCGCTACCGCCCAGCAGCAGCGCTAGAAGCT
GACACAGATCCTGCAGCACTAGCACTGCCTTCTCCGTCGCCAGCGTCGCCACTGGGCGCATGAGCTTGGGCAGCAGCTTCCGCAGCTTGGTTAGTATAGT
CTTGCAGCGGCGGATGGCCGCAGGTGAGCCCGAGTCGTACGCGCGGTCGTCATGCTGCCGCTGGTGCGCACGAACGTGCCGCAGTAGACTGCCTACATCG
CTCTTCTCCGCGTCCTCGACCAGCGGCGGCGCCATCCCGAGCGTCGTCATGGCAAGTGGTGGCGAGTGCAGAAGACAAACACTCCCACTTCAACGTACTT
AAGTGGATTGTACGTGGTGCGTTGTACATAGGTTGCGCGGTGATCGCACTAAGTGCGCCCTCAACGCTTGGCAACCGCACGCTCAATCGAAGATGGCGAC
CAAGGGTGTGTGGCAGCTCAAGCAGGTGACAATCCGTTACTGCCAGCACGGCGGCAGCAGTCGCCACGTGCGACAGCTCCTGGGGACGAGCGCTTCCTCA
AGTTCGTGGAGGCGAACCCGCAGGTGCAGTTCGAGACGGAGCTCAAGGGCGCGCGCCACCCCGTCCTCATCGGCGACTACGGTGCGTAGCGGGCACTGAA
ATTGCGGTTATGGATTGCAAATGGAGGTGCTTAAATGACGTTTTGGCTGCCTAATTCCAGTGACAAATGAGCGCAAGGTCAGCGACATCAAGAACCAGGA
CATCCCCTTCATCCTGGACCAGGTGCGGCTCACAAGCGATTGACACACAACGCAATACTGTCTGGACTGGTTGTCAGCGTTGCTCCCTACGGCTACTTTG
CTAACGGCTACATGTGATTATGGTGGCGGGCAATTCTTCTGCAGCTGGAGCGTCTTCGTAATTCTAGCGGCCGCAAAATGACGCACATCAAGAAACCCGT
GATCTCCAAGCGCCCGACCATCCAAGGCATCTGGCAGCCGGACCTCGACTTCCCGGAGTTCAAGATCAGCGACCGCACGTAGACGTCGATGCTACTGGTT
TGGGAGAATGCAGTTTTCAGGGTCGTTAGCGTAGCTCATTAGCAGCAATGGAGTTCACTGAACACTGCAACAGCACTGCACAGGCTATCTCAACAAGTGA
AGCATCAAATATATTCCTTCAACAGCCGCCGAGAGAAGGGAAGAGAGGTCCACCACCTCGTCTTCCACCTCCCCTCTCTTAACTCTTGGAACTACGAACT
AGCAGGCGTGTTCACGCCGCTGCGGTAGCTCAAGCTCAAGCTCAAGCACCAGTGGCGCCATCCAGCTTAGAAACCGTGCAGCACCACCTGGGCGTCCGTG
CAGATCTCCTGGTCCAGCAGGAACTCGCGGATGTTGGTTCGCTGGTCGCCCGACAGCTGGATGATCTCGCCCAACTCGTCGTCCTTGACGATGGCGCCGT
TGCAGCTGAAGTTCTTCTTGAAGGCCTTGAGGATGCGCTTCACGTCCAGGTCGTCGGCCAGGCCCTGCACCGTCGTCAGACACTTGCGGCCGTTACGCTG
CTGCACACGCACGTGAACCTTGCCACCGCCGATGCTCGAGTCGTCCTTGGCGTCGGCAAAGGCGTCTAAAAAGAAGCAATCAAATCAGTACAACGCTCCG
CATCTACCTGACTACTGTACACCTCCATATTCACCCTCCTACTTCCGCAATAACGCACCGAAGGTCTGGAAGTTCTGGATGTCGGCCATATTCGCTACGT
G