Description :
From Genome Similarity Track
Location :
Scaffold_897:5224- 7127
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_897-fgenesh-gene-0.2Myosin

Sequence
1903 bases(100 bases per row)
CGGATATCCGCTAGCAACATCTGGACGGAAACCAAGACCGAGTGGGACGCCTTCCTTCCACAGCACTTCATAGTCTTCTTCGCCTAGCAGCTCGATCGAT
CCAGAACGCATGCGGAAGGACTCGGTTGGATTTCTCAAAAAATGGAGGCGGACAGGTTTCTGCACTTCCTGCAGCAACGACAAAATACGGCGAATGTCGC
CCTTCTTCACCTTCACCTTGCCCACGGCGAGCAGCACATCGCCGCGCGAGACTTCGAAAATATCCGCGCAGTTGCTCAGACTCTCGTGCACACGACGCAC
GATCGGCATGCCTGAGATCGGATCACTCTCAAAGTAGAGGCCCAGCAAACCGCACTCCCACACGATCTCATACTCATTCTTAATTTGCTTGGGCGGCTCG
TACGCCTCCAGTCTCTTCTTCGAGTCACGGTAGTGGTTTGGACTGTGACCACCGTAGCGTCCGTCTGGGTCGTAGATTTCATGGTTGAAATCGCTGCCAC
CACGTTCACTTGGAGGAGCGCTGTGAATCGAGATCAGTGGATTCAGACGATCTTTCTGAGAATGAAGAGAGAATGATCCCTCCAGCGAGTCCTCTGTTGT
TCGGTCGATCGAACCAACGTATGACACGTCATGCTCGAAGCTCAGCGTGTTCGCCGAGTATTCGCGACGAACCAACCATCCGCGAACAAACGACTGGATC
ACTGTGACCGCCTTCACATGCCTCACCAAGCGTCGAGACAGAAAGCCACGAGCAGCAGCTTGCAGCTTGATTGCGCTTCGCTCTCGTTGAATGATGTGGA
GATAGCGACGGCGACAGGAAACGCGACGCCATGCCGACTGGATCAAAATCGCAGACTGGCGCTTACGTTTGTAGACACTGCGAGCCGCATACCCCAAGCA
GTAGCGTTGCAAGGTGATCACGGATTTGTACAACGCCTTCGCACGAGCTCCCTCCAGTGCGTTGTGGGCTTCTGGGAGACAAAATACCTTGGTCTTGCCA
ACTTGGAAAGGCGGGTGCTTCGACTCAATCTGTAACTTGAATTGTGCAGTAAACTTCGCCACGAATTCCTGCGCCACTTCCTTGAGCTTGCTCGGAGGGG
TCTTCGACTGCTGCGAAAGAATGCAGCTGTAGTTTCTGATGAACACTTCGTGCGCAAATCGCACTGGGTAGCCACTTCGAGAAATCTTCACTGCTTCCAA
CACGCCGCTGCACCGAAGTTGCTCCACCACGCGCCTCTTGTCAAAAGCAGTCGAGCTCACTTCGTCGTTGGGCTTGATACAGCGAACAAAGTGCGGCTCG
GTCGCATTTAGGATTTCGAGAAGCGAAGTGAGCTGGCTCTTGAACTGGGCAACCACAGTAGAGGACATGATACCAGATCGGCGGCGAGTGTCACTTGATC
GATCGTCCGTTTTGCGACCGGAGTTGGTCGGCGACGTGGCAACATTTGTAGTCTCAAAAATCGAGCGAACGAAGCCAAACTTGGACGTCTTCAGCAAGTC
GATCGCCTCGGTGTGCATGTGGTCCTTGTTCTTCTCGCAGAAACCGCTCGATGTGTAGCACACATTGCCAGCGTAGTGTTCGATCACGAACTGACCCTTC
GCACGTTGCAGTCTCGAGACCGAGAAAGACGATTCCTTCAACAAGCATTCGTAGTACTTGTTCGCGAGTTTCTCGTCGTTTCCTTTCGGAATCAAGCACT
GTTCGTCTAAAAGCGAGAAGAGTCCCATTTGGCGTTTCTCGAGCATCGTCACGCAGATATCGTTGTTCGGGTAATCCACAAACTGCCACGGGATCTCTTC
CGTGACGTACGTTTCCTGCTCCATGCGGAACACGAATCTGCCGAAAAGCTGCTGCAGTTTCTCGTTGGCATAGTTGATACACAGCTGCTCCAGACTGTTT
TCT