Description :
From Genome Similarity Track
Location :
scaffold_168:52224- 57727
Transcript NameFunction/comments
g4985.t1 eukaryotic translation initiation factor 5B
g4986.t1 conserved hypothetical protein

Sequence
5503 bases(100 bases per row)
TCACGCGAGCCATTGATTGCCGAGCCAGTAACAGAAATCCTCCACATCCATCGAAGACCAAGATGCCGCCGAAGAAAGGGAAGAAGAACGCCAAGAAGAA
CGCAGGTGCGGCCGCCTCAGACGACCTCGATGACCTGTTGAACGAGTTCGCGCCCACGGAGGGCTCCAACACGCAGCAGGCGCAGTCCAACCAGGAGGAC
AAGAAGGAGGAGGAGAAGGAGTCGGACGTGGACGCTGCCGCCGCCGCATATCTGGCGTCTCTGGGCGTCGCTCCCGCCGCTGGAGGTGAGAAGAAGGACG
ACAAGAAGAAGAAGAAGAAAGGAAAGAAGAAACCGAATGCCGACGCCAAGAAGGACGACGACAAGAAGCCCACGTCCGCCGCAGCCAAAGCTCTGATGGA
GCGCCAGGCGGCCATGAAGGCTGAGCAGGACCGCCTGGAACAGGAGCGTCTGGAGCAGGAGCGTCTCGCTGAGGAGGAGGAGGCCAAGCGCCTAGCCGAG
ATCGAGCGCGAGGAGGAGATCCGCCGCAAGAAGAAGGAAGCGCGTGCCGCCAAGATCGAGCGCCAGAAGAAGGAAGGAACGTACATGACCAAGGCTCAGA
AGCAGAAGGCCGCCAAGGCTCAGGCTGCTCTGGAGGCTATGCAGCAGGCGGGTCTCGTCCCTGATGCTGCTGGCGAGAAGAAGAAGGTCGTGTACTCGAA
CAATAAGAAGAACAAGAAGAACAACAAGGGGGAGTCCAAAAAGGAGGAACCCAAGAAGGTCGAGCCCAAGCCCGTGGAGAAGGAAGAGGAGGAGGAAGTA
GACGACTGGGAAGCCGCCGAGGATGCCGCTCAGGCGCAGGAGGAGGACGAGGCCCCCGACGCGTGGGACGATGAGGACTGGGAGACCAGTGACGTCGTTG
CCTCACTGGAGGACAAGCTGCAGGAGGTTAAGGAGGAAACCGCTGCGGTCGAGAGCAACAGCGATGGAGACGAGGATCTGCTGGTGCTGGAGCAGAAGAA
GGAGCAGGAGCGTCTGCGCCAGCAGGGTATCGCGCTGAAGAAGCGACAGGAGGAACAGGCCGAGCAAACGCGACAGGAGGCGGAGGAGGAGCGTCAGCGT
TCGAAGGCGAAGCTTGAGGCCGAGCGCAAGAAGAAAGAGGCAGCTGAGCGTCGTCGCGAGCGTGAGGCTGCTGCACGTGCCAACGTGTCCCTAGACAATC
TGCGTTCGCCTATTTGCTGTATCATGGGCCACGTCGATACTGGTAAAACGAAGCTTCTCGACAACATTCGTAAGACCAAGGTGCAGGATGCCGAAGCCGG
TGGTATTACGCAGCAGATCGGTGCTACATTCTTCCCTGTGGATGCTATTAAGCAAAAGACTGCGCGCCTCGCTGAAACGATGAAGCTGGAGTACCGCTTG
CCTGGTCTGCTTGTGATCGATACGCCTGGTCACGAGTCTTTCACAAACCTGCGTAATCGTGGTTCTTCGCTGTGTGATATCGCCATTTTGGTGGTTGACA
TCATGCACGGTCTGGAGCCCCAGACGCTCGAGTCACTGCGCCTGCTGCGCCAGAAGAAGGCCCCGTTTGTGGTGGCTCTTAACAAAATCGATCGTTGCTA
CGGCTGGAAGACTATGCCCGACATGCCTGTTCAGGAGGCCCTCAAGCACCAGAACGAGCACGTCATCCGCGAGTTCGAGGACCGCATGAAGGCGATCATC
GTGGAATTTGCTGAGCAGAAGCTGAACGCTGAGGTGTACTGGCGCAATAAGGACTTGGCGCGCACGGTCTCGCTCATTCCTACCAGTGCTATCTCGGGTG
AAGGTGTGCCGGATCTGCTGATGATGCTGACCCGATTGACACAGGAGCGTATGGCGAAGTCGCTTGCGTTTGTGGACATCCTACAGTGTACTGTGCTCGA
AGTGAAGGTCATTGAGGGTCTCGGTACGACGATTGATACGATCCTGGTAAACGGTACTCTGGAAGAAGGTGCAACTATTGTAGTGTGTACATTGGACGGA
CCAGTCGTGACAACGATTCGTTCGCTGCTGACCCCACACCCCATGAAGGAAATCCGTGTCAAGGGAGAGTACATTCATCACCAGAAGATGAAGGCTGCAA
TGGGTGTGAAGATTTGCGCGCAGGGCCTTGAGAAGGCCGTTGCTGGTACTCAGATTTACGTGGTTGGCCCTGATGACGATGTTGAAGAGCTGAAGGACTC
CGTTATGTCCGACCTGACGGGCATCTTGGACTCCGTGAAGGCCACCCGCCGTGGTGTCATGGTTCAAGCTTCCACCCTGGGTGCCCTCGAGGCCCTTCTG
GAGTTCTTGCGTACGTGTGACCCGCCTATTCCGGTATCGTGTGTGAACATCGGCCCCGTACACAAGAAGGATGTTATGCGCGCCTCAGTACAGCTGGAGC
ACCAGCCTGAGTTCGCCACTATCTTGGCTTTCGATGTGAAGGTTCATAGCGACGCTACTGAGCTGTCCTCAGAGCTTGGCGTGCGTATTTTCACGGCCGA
TATCATTTACCATCTTTTCGACCAGTTTACAGCGTATATGGACAACTTCCGTATGGCTCGCCGTGAGGAGTTCGCCGAGGTGGCTGTATTCCCGTGCGTG
TTGAAGATCCTGCCTAACTGTGTTTTCAACAAAAAGGACCCAATCATTCTCGGTGTAGACGTCGAGGAGGGTATTCTGAAGATCGGCACCCCGCTCGTGG
TCCCATCCGCCGGAGGCTTCCTGGTCGGCAAAGTGGGCTCCATCGAGCGCGAACACAAGGAGGTGGATCGCGCCAAGAAGGGCGCGTCTGTGGCTGTGCG
GATAGACAACGAGAGCAGCGTCATGTACGGTCGCCATTTCGACCACAAGAACAAGCTGGTGTCGCGCCTCACCCGCCAGAGCATTGACGCGCTGAAGGAG
AATTTCCGGGAAGACCTGCAGAAGGAGGACTGGCAGCTTGTCATCAAGCTCAAGAAGGTTTTCGATATCATTTAGAGCGTGTGGGCTACGCGCAAGAAAT
GCAGTGGACGTCCACGCCCAGAGAGAGAGAGCGTCAAGAGGAGTCTCCTGTTGAGATCAGTGCAGGTTCTCGCCAGTGGCGACAGTTATGTTCTAGCAAT
ATATGATTTCACGCACCTCTTTTCGTCCACATGCAAGAGCTCTTGCGGATGGAGTTCAGTCGCGTCTAGCACTGTAGTGACATCGCGTCGCCAGTGGTCG
CTGAACGCTGCCGCGCAGTGTGGGCTCGAATCGCATTGCTAGCGCGCACGTCATAACTCCGTCGTAGGTGAAATCAGCTCCGCATTACCGCACCGGGAGC
TGGGTGGGTCGAGTGCATGGGTGTATGTTACCAATAGTCCGCAGCACCGGTGTGGCGTCACGGCGCTAGCTGTGCATCTGGAGACCGGATTTTCTGCTGC
AGGTGATCGATCTCCAATGGAGACCGCGCTCAGAAGACGCACGCGCGCCGCGTCATGTAAAGCTCACCAGCACCACGACACCAGCGTTGCTGCACCAAAA
ATCTTGGCAAGACTGAGCTGACAGCAACGAGCATGCAGGACTTGGTACCAGTGCTCGCGCTTGACCCACATTTCTAGTTGCCCCTTGCCGTCCCCGCTGC
TTTCTCGACGACGTGTTACCTGGACCGAGTCCCCGAAGCTAAAGATGCGAGCTCGTTCGCTGCGAAGATGAGCAACACCATCGCGGCATTGTACCTCGCA
TAGGCACAACCAGGCAAAGTCTCTATACCAGCGACTAGTGACTCATTGCAACTTCCAGCAAGCAGGAATCGCGCGTTCCCGGGGAGGCAGTTCGTGTTGC
TTGTTGGCGCTTCACAGCCGAGTTGACCGTAATTGATTGCCCACAGCCCTTACCGAAGTATAATATCCAGACTTGCGGTGACGAGCTCGATGTCCAGGCA
GTTGGTCTGTTGAGTCATGGTAAAGCTGCTTTACCTGGGCAGCAACCTCACAGCTAGGTGCAACGCTGGACAAGTACTGTGACTGCAGTATTACGTGTGG
GTCAAGTTACTTGACTCAACTATGGATCCAAATTGAAGTTGGAACAGCAGGAGGATTTGCTGGTCAGTTCGAGACGAGATCTGTCCAGGAGCGACAGCCG
AAAGTAAGACGTGCGTCAGTCGGAACCTTCCTGCTGGGCGGCGGACGAAGCGAGCAAAGGGCCTTTATAAGGGTGCACCCAGCTGAACGGGGCGAACCGT
GCGGTTCAGTGGCGCTGCGGTCGCGCTGGCCCCACGCGCGAAGCAACATGCAACATGGAACGCAGGCGTTCTTCGCCCGTGTTGTCGTCGACGGCGGGAC
CACAACGGGCGCTTCTGGTGGTAGGACGTGCAGCCAATTGCGATGATCCACTGAAAAGCAGGACAAAACGGCGGCACGAGGACGCCGTCGTACCTGCCTC
ACTTCGCAATTGGATCTCCACGAAGCAGTTAGCTCTGTCCGTTCACTGTTCTCGCTTTTCGATCGGCGCTATGATGCACAGAATGAGGATGCCGCCCATG
CAGCAGCTCAGCAGCCACCCGGAGCGCAATGTCGTGGGCGTCGTAGTCCCTACCGCCGCCTCCAAGGCGAGTACGCTTCGAGCGATGAGAGTGCCCAAGT
TCTTGCGCAGTCTCTACGATATCCTCCACTACGAGGACCAGTCGATCCTGACGTGGTCCAAGGACGGCGCCTACTTCCAGATCTTCGACACCAAGCGGCT
CGAAATCGTCGTTCTACCCAAGTACTTCAAGCATGGCAAGTTCGCCAGCTTCCAGCGCCAGCTCAACAACTTTGGCTTCCGCAAGTGGACCAAGACGCAG
TCCAGCGTCTGTACTTTCAGCCACCATCATCTCGTGCGCTGCCACCCACAGCAATTAGCCGATTTCATCAGTCGACGTCCTTCAGCCAACGGCGTGCGAT
CGATGGCCGACGCTACTTTGACTACCAAACGTAAACGCACATTTACGGAGCTAATGCGATCATCAGATACTGGGGCTTCCACCACTGCGTCAGCAAAGAC
GATCAAGCGCGAGAACGAGAGCTATAATCGCGCATCGCAATTGACGGAGCGCAACAACTTGGCCATTGCCACGAACTCCCCTCTAGCCAAAAGTACGCCG
CGATGGGTAACAGATCCGGTGGGCTTCTTGAAGGCCAGCGAGGAGGCAAATGGGACTCCTACCAGCGCGTCATCGGAGCAGGCGTTCAATTTCTCGGTGG
AGGAGCTGCACGACCTCATTCTGCCCGTGGCCCCGATGTCGGAGCGCCGTGACAGCCGATCCATGGAGAAAATGCTCGAGCTACGCATGTTGAATGAGTG
TCTGGATTTTGGAACGACCGGGACTCTGTACGCTGCCTCAAACCCCGCGGGCAGCGAGCTCTTCCCCTCACTCCCATATTCGTGGGACACGGACTCATTT
TTCGCTCCTGTCGGCCGCACACACTCTGAACAAGACCGTGGCCCATGGAGATTACATTAACGTAGCAACCAACGACCACGATATGTAGTTTAGAGCAGTA
GTA