Description :
From Genome Similarity Track
Location :
Scaffold_74:52223- 54691
Transcript NameFunction/comments
Phymu_g3516hypothetical protein PHYSODRAFT_293856

Sequence
2468 bases(100 bases per row)
ATGAGAATGAAATGAGAAGGAAGCGAAAAAATGGGAACGACTTTAATTTCCTTTTAAATACTCGTCGGAGCCCTTGTTGTTGATGCGTATAGAAAGCTGC
ATTGTCACCTGGTGGTTTCACGAGTTTTTTGCTGTCAAAGTCGTGAGGGGAATACGTCTCTCGGATAATAATGCCGCCATCGATGGTTTACATGACTGTG
CATCCAAACCAGGACTCATCTGCATCTTTCGCACGAGTGCCACTAACGTCGTTGCCCAAGTGCTTCATGGCCGATGCTATATTGGCCTCAAAGTAAGGGT
GCCAAACGTGGTCGTACAGGAATCGTGCCGTGAATGAAAGGTCATCCTTATACGCTTTAGCAACCTTGGTTCCACCCCAGACACGACTCCGCTCCACGAT
CCATGGTATCATCACACGCTTTGGTCTTGTCGCACGAAAGATCCGAGGCATGACATATTTTTGAAAAGCTTTCTCCGAAAAGGCAAGCTCAATAGCAGGC
TTAAaagcctcttcttccagtgccagcacgttgaagagaAGGTGGTTAAGTCGGCGGATGTCGTCTTGCAACATGCCCAGGCGGGTTTGCCAAGAATCcg
ctgacgacgctgctgagaagaccagatcgtcttcttgggcAACGACAACGTCTACCAGCGCGAAAATCGCTTGATACAGAGCAAGGATATCACGTTTCTC
CACAAACCTGATTGCCACAAGCGGAAGGAGCACCGTATTCTTCACGTCGTGCTGGCTCCGAACGAACTCAACGAAGTGTAGCTTGAACCATGCGAAAAAC
TCGCGCACATTCCAATTCATAGCCGATTTCAAGTCACGACTCCGCTCCAAGAACCGATCGATTACAAATAGAGCATGTCGAACCGGCTCATGCAGTCCAA
GCAAAAACTGTGAGTTCCAGCTCATGTCCACTTCATCGTTACAGGTCAGCACGTTTGAAAACACCACCTTTTCCCCCTTCCTGATCGGTCCCGATACTGG
TGCGCTCTTCACACTAGCAAAATCATCCGAAGACAGTTCTCTTCGAAGTGTGCTAGCATTCATTCTCAACGGCCCCAGGCTCAAGATACTTGAGGGAGTG
ACGACAGATGAGCTTTCCTCACTGCTGTGCTCGGAAATGGGCGTCGACAGGTTACTGGCATTTTGTTGTGTCTTGCTCATCAGCACATTTCTGGCAGCAA
TGGCATTCTGCTGCGACTCGAGTGAGGCCCAGATATTGAAAAAATCCGTGTCGTTTGAGCCTTCGTAGCCGCTCTTGTAGTCGATTGTCGTCAGCACATG
AGCAACTTGGCTAATGTCCACGAGTTGTTTGGACTTCTTGGCTACGGGTACTTCTTTGGCAGTCTCGGGTGGGGACCAGATATTCGAATAGAAGACGGTC
TCGTCGCTTGGCAGGCGCCGCGGTTTCTTGACACGTTCGCTTTTGGCCACCATTGCTAATCGGCTTTTCACGAGCGGTTTGCGATTGGGGGCGACAACAG
GCTTCATTGCACGGCTGCGAGGAAGCACAGGATCTTCTCGGTGCGCGCGCTTGAGCGGCAGGTGCTCTCTGCCAGGCAAGTCGCTCTGCACTTGAACTGG
CATGGtctcttctctttcttctaATACACCCGCTTTCTCTCCCTTGCTCGCCACTTGAATAGAGGGCAGCTCAATTCACCAGATGCCACGGTGATATTTA
GCGGGCAATTGGCCGTGGCTTGAGGCAGGTGTGTTCCAGTCGTCGAATGGCGAGACCCCTCGGAGCAGGTGTCGAGTCTCAGACAGATGGGAATAAACTA
GCACAAGCAAGAGAAGCGAGGGGGTATCACAGTGAGAACAGCGCGTTGCACACGACAAGGCGCGTGCTGAGAGTGCCCGCCGCACTTGTCAAAGAGAAAC
ATGTGCAGCCACCAACCTGTCTCGACAGGGGCGACCTCGGTCGTTACTGCCGGTTTCGCGCTTGATTGAAGAATGAATTGGCCAGCCAACTCGCGGCAGA
GAGACGAACGCGGCTCGGGGTAGCGGAGACTTGCCTTTGCCTCAAGTGCCAGTGCCACAGGAGACTTTCAACCCCAGCCGCCAGCTGGGAGCGCTACAAC
CATGTCTCGGGTTTCCAGAGAGCGGTCAATACGCTCGCTGCCGAACAGCCAAAAGAAAACCGATCTCGGACATGTACAAGTTGTATCGCATTGGACTGAC
CATTACCGAAcacgacagcgacgaggtgAAGCCTGCACCTCACCGTGAAGGCTCAGCGACTGGCATGCCACTGAGCGAATTTCTTCCGAACCGGATTGAA
AAAAGCAAAGTTCTTCACTTGATTTCAGTTCCGATACAAAACGGGATGTGCGGAAAGTTAAAAACGACCAGCTACAATCTGACTGAAGTTCCCTTGACGA
TGGCTGAAGAAGTGCCCACAATCACAAGCTGGAAACTTTGCCTAGATGTCGACGCTGGGCCCGTATCA