Description :
From Genome Similarity Track
Location :
scaffold_696:5222- 10041
Transcript NameFunction/comments
Pl_102925hypothetical protein CRE_25423
Pl_102926hypothetical protein PHYSODRAFT_312106

Sequence
4819 bases(100 bases per row)
CAATGGAGTCCTTCTTTCCGTCGGTCTTTGGTGTGAAGTGGGAGCGGAACCATATCGTGGCTATCGATTTGTCGGGAAACGGACTCGCGGGGGCATTTCC
TGTCGAGATAGTCCAGCTACGTTTCCTTACAACACTAAAACTAAGAAACAATCCGAGACTGTGTGGTGCGCTACCCAAGGATATATACTCCATGCCTAAC
CTAAAGTACTGCTACGTGGATGGTACGAAGGTCGAAGATGCGCTGCCGTACAACATTGCACACTCTTTTCAAATTACACAAGTAAAATCTCAAAATGGTA
AGTCTGGTAGGGCAGCCGTATCCACGGTGAGGTTTTGCACATGTGCCGAACATACAGGCAACCTTATCCACTGGATGGTCGACATGACCGAGACCGAGAT
GTACATGATGCACTCAGCACTGAAAAAACTTCAGGAACCAAACCCACAAGCTCGTCGTCAATCGATCAAGTGCACAGCGAGTAACGCAACAGGACCAGAA
CGTGCTGCCGCCGCCATAAAATTGCAACGTATTTATCGAGCACGCATTGAACGTACCAAATTCCGCAACTTCCTGCACTCGCTGGTTGAGATGAAGGTTG
ACCCTGGCACAGGTTACACCTACTATGTCAATGCGCGAACCGGAGAGGCCACGTGGGAGAAACCAAAGTTTCTTGGCTCAAACGTTGATGCTCAAACAGC
CAATACTGATGAAAGCTCAAACAACAATCCCCTTGATGTTAAAGACGCCTGGAAACCTTACGACGATGGAAACGGCAACACGGTAAAATGTCTAAGCATG
TTTCGGTTCATCTTAGAACGCTACTGACTGTTATCAAAAATTGCGATTAGTACTATTGGAACAGCGTGACAGGAGAATCGACATGGGAACCACCAATCTT
CCTCAGTCGCATATATGAAGAGTTGCGGGACCGCTACGGTTCTGACAAGACGGACGAAGAGAGGTTCGAGCTGTTTTTCCTGGATATCGACCGTGATGGC
ACAGGAGCTATTGATCAAGATGAATTTGCGCGTTTGTGCGGTGATCTCGGGATGGCCTTGTCAGCTAAGCAAATCCAGGAAGTATTTCGCGAGCTCGACA
TCGGCGGCGATGGTCAACTTGATCGCTCAGAAATCGTTCAATGGCTTACGCGAAACTATAAGTGAATACTAGTACCTTACAAACCATAAACCAATACTCA
AAAAGTGTCTCTATTCATCATCACAGAGGAGCTGCAACAACTTCTCGGAGTCAGCGATCGTACGAGTTAAACCAATGATCTGATTACCACTGATCAAATA
CGTATCAGTGCACGCACACTTGACTGATGGTGGTTCCGAGTCATCGAAATCAGCAATACTTTCCGATCTGCGGAAAGTAGCATCGAACTCCACAATCACC
GAGTACCCGATTGCTTGGATGCTTTTCTCTTCGACAGAAATTACATCTAGGCATTGCTTAAATAATGAGGCGTACTTGATAATGCCCTGGTCACCATGAT
ATGTTCCCCAAAATGGCATCTCCTCGGGCACTTCGGATTTGAGGAAAAAACTCGCAGACGTCATGGGTCCCAGCAAATTGACGTCGGGTAAAACCAGATA
CAGACCATTACGGTTTTTTGCTACACACTCCACCAGCGTCGTGTTGGCAGCTTCGTCAATGTCACTGAAGCTGTTGCGCGACATTCGTGTCCTGGACACT
GCAGATTGCATAGCCTCAAACCATTTCATCCTCGTCGTGTCAGAGCGTGTTACGAATGTTAAAGTTTCATCTTCTTCACGATGACCATCAAAGACCTCGA
CCTGGAAACCAAATGCACCCCTGTCCGGCTTTTTCAAACTCCGACCGAACGCAATCCATTTCCGAGCGTTGCATACGACCAACATCTTGGGTCGAGACGT
CCAAGTTTGCTTGTGTGCCATCAAAAACTGCTTCAGCATCGACGCTTTGGACGGAGAAGTTACTTTAGATACGCCATTACTTGGTGATCCGAACGGGGCA
GTTGATGCGTCCTGCAAAGTCAGCTGACAAGTAGACTTCTCGAACCTCAAATGCACCTTAGCCCATTTTGAGCGCTTCTGGTAGGCATACCCACTCACAA
AGAAATTGTCTTCTTCGACATCGAATGGTGTGGACTCGTCTGACTGCAAGATGTCGATAATGGATTCTGGGAATTTGCTCTGTGATCGACTTTGAAACAT
GTCACTTGGATGCACCGCTTCATTTCCTTTTGCCAGATTTTGAGATGATCCAAAGCCTTCTTTCTCCATTGGTAGCCGTCGAAACGGCTCTAGCTCGCGT
GATAGGTACTCACTTGCTGAAGAAGACGGGCGAGCAAGCAGGAAACCAGTATCCGCATCGTCATCACTAGCATTCCGCTTTCTTGGGGTCCCATTGCGAC
CTCCCCCTACAACAACTTTTAAGCTAAGAAGCGAATCATCTAGCGCGTCCATCTGTTGATAGTGTGTAGCCACGAGAGAAGCAGCGAAATCGTTCCAGCC
ATTCACATTGTTGCAGAACTGGCGAATAAGTTCTTGCTGAAGGTTAGGCGAGCTGCAAATCTTTGCAATCTTTACTCCAATGATCGCCAAATGAGCGTCA
TATATATGAGCAGAACTGTTCGTATCCAACTTGTGCAAAATAAACTCCAATATCGAGTCAGGAGAGCGGAAAACGCTCCGTAGTAGCGGGTTGTTCACAC
GCCCATTTGTCGATGGTCGATTCAGTAGGTTCAAGTAAAGTTTCACCAGACGGCAGTGTAGTATGCTGGCTTTGGGAAACTTCTCGAAAATGTCCATCAA
CGAGGTTGCTAGATCCAACCGAGTCAATCGACTATCGATGCGGTCTTTCGACATCAGAATAACAGCATCCAGCAACTCCACGACGTGCACGACAAGCAAT
GTCGATGCCAATGGCCGATGATTCACTACAGCTTTTCCAGATCGAGGCGAGTAGCTGAGTGCGGGAGGGTTTATTCCCATATACAGAGTACTTCTTGCCG
GTGAAGCGTCACGCTTGGCAGGCTTGCTGGGGCTCACTTTTCCACTTGAATTGGTTAGCGTATTAAAATCCTCCCCGTCCTCTGTCCCATCGTTATCAGA
GTCACTATCACTAAAGCAATCACGAGCAGCGAATTCAGATATTGTAGTCAGGTGCTGATGGTAATTGATCGACGCGCAAATTGTATCCAACACGAGATGA
ATTGGTGTGACAAAAGCTTCCAACTTCTCATGATCATGCCGAGAGAATTCAATAGCATGGCGCAAAATATCGACCACAAGAGTTCGTGGGATGCACGCTC
CGTTCATGTGGTGAGCATCCAAAAAACGAAGTTCTGCCATTCCAAGCTCTGCCAGTCGAGCTAGGAAAGTTGAGTTCTCAGTCAGAGCTGCCAAGACTGC
ACATTTGAGCTTGTAATGCATTGCAGGATCACTTGGGGCCATCCTCGGGGGAAATAGTTCCTTTTCAAATGTCTCTACACCCTCAAACGATGCCAGCTGA
ATCTTGGTTTGAATGTAATACCTGAAAGTATTTGGAAATTCGTCCTTCAGAATCTTTATCAAGACCTCGGCGCATCCGCTTATCCTTGAATGGACCGTAG
ACATAGTGTTCGAAGTAAACAATGATGGAGATAAAGGCGCCGTCTTGGATGAAAAGAACGAAGATGGTGACATATTTGGTGGTGATCCACCAACAGATGA
TCGTGGAGACGCTGAAGACGTAGATGACACTGTAGACGTTGAAGAGACAGAAGACAGAGATCTAGTCAACCGATTTGGCACTTGCTCTACAATTCGTTGT
GTAAGACATCGAATGATTGGGAAGTACTCAAAACCCCGTCGGATCGAAATGAGAATTAATCCATGCAACAGCGATGCGATATCCGGGTTGTATGCATGCC
CTGCAAGACGTGATAGTAGCCATTCATTCTCGTCGTCTTCGTTCTCATCACAGATCAACCTGTGCACCGCTGGAAAAGTGACAAAATGTTTGGTAATTCG
GCACATATTGGAGACCAAGACACCATCAAGTTCCACTTCATCATCTGCCACACTGCTCTCCGCGTTAACTTCACTATCATTCTTCTGTGGCCGCAAAAAC
CGGAACAAACTTCCAAAAATGCGTTTCCACTCGTTTGCTGTCAAATCTTCAAGGCGCAACAAATATCCACGCGTCACGGGGTCCTCGAGCAGTTCTTCAT
CTTCATCTCCACTCACACTAAAGTCCGAAATACTACTTCCAGAGCTCTCAAACCTCATACTCGCGCGTAGACGTTGAATCCTGGCCATTTTTCTAGTCGA
AGCATTGCTCCTAAAATCCATCATCGTCGTCATATTAGTCGGCAGAGTTTTAACCGACAAAGCCAGCCCTTCCAGCTTAACACTTGGTTGTGTTGGTTCT
GACTCCTGTTCTGCACCTGTATCTACCATATTTTCCACTTTTTCATCCAAATTCTCCTGTTTCGGTTCTCCATACCACGCCATGGCTTTTAGATAAAATC
TGAGAATAATCTCCGTTGCCACATAAGCCTGTCGATATTTGTCCGGGTGTGAAATGGGCTCAGTTGCATTTGTGTCCCCATTTTCAGTTAAATTTTGGTG
CATTTCACTGAACGACGTTGCATAGGCGAAGACCTGTTTGATGGACTCTGGTTCTAGCAACAGCTTCTGGACAGGTGAAAAGTGTCCTCTTTCTCTCCGT
TGTACTGTAGTGAGCACTGTATCAACGTCGTAACAGCTGCAAAAGACATTGTCGAGTGCTGGAGCTTGACGCAAAGCTTCTGCATTGTGTAGAGCCTGAG
AAGCCTTCAACGGGTCGTG