Description :
From Genome Similarity Track
Location :
scaffold_12:522174- 523817
Transcript NameFunction/comments
Plaha_PHALS_13277Predicted membrane protein

Sequence
1643 bases(100 bases per row)
TCGATACGTTGCGCTACCACGATGGAAACAGCTGCGCCAAGCTGCTCAGTCCAACAATTGCAAAATGTTTTGACACAAATTCAAACCCTCTGCACTaaag
cttttgaaaaaggTACTTCCAGCAAGCATCAACAGATTCGAGTGATGCATTGGGTGCAAAAGCTTCGCAATCAACCCACGTCAAACCCAACGTGGTTGAA
AAATGTGCTGGAATATGCAaatctgcttcttcaaatgatcgTGAATGGAGTACGGTCAAGAGATTGATCATAATAGCAGGAGCTTAAGATTTTTGCTTCG
TTTCAAAAAGGTTTTTGAAGAGCCTTTTACGAAGATGCCTTCTCAAGGACCGTTGGCAGCACTTCCAAGGCATCAGGTGAGTTAAATTTTACCAATATCA
CGTCAATTTTGTTTTATAAACGTAGTGTATCTTAGGTCGCACGCTTGCATGTAAAAGCAGCAAAACGGACTAGCAGAGCTCAGTCAGCGCACTCTTCATA
CAGAAGAAATGAATCAAAGTCAGAAATTGAACAACCACTAAACAATAATCGCGATGATAAGGTCCATAGGGGCACTATGGTGAGTAAAGAGATCCAAACT
CTCGAGCAAGATAATCAATGGGAGTGGCAGCACGTCTGGAAAGGTGCGTTTGATGAGATGCGTCAGCAATTGCAGTTGAAAACTGAGACAGTTGAGACAC
TTACGACTGAAAACAAGGTGAGTTGATGTTTTTCATTCTATTGAATATTGTAATTTATTGTCGGAATAGgagctgcgtgctcttgTTGCAGGAtatcaaa
aagctcaagaagaaattgagcGTAACCAGCGCGATGCAATGTCAAGGCACAATGCAGAGATTGAAAACCTTCGAGCAGTCCACTCTTTAGAGCTTTCAGA
TGTTAAAGCTCGACATCGCCAGAAACTACAAGAGGTGATGCTGCAGAATGAGGAAAAGCTTAGAAGACGACGATTGAAAGACGTTGGATTTCGGCCGACC
GACAGCAATAATTATTCGGTAAATTCATGTTTTTGCTGGTCTCATTATTGTCGTCTAACTGGTATATTGTTACAATATTGCAATAGTCTCGAGACGCTAA
TGCTAATGCCAATGCTGCTTTTCTTCAATATATTGACGACTTTTATTCTTCTACGCTTCATTTGACAGCGCAAAATAAAGTCTAATTCAAATTAATCAAT
aaattgtacaatatttAATTTGATCAATATCTGAACCAATAGTCAATATGGCAAGTAAGAATTTACAAGGCGATCCACGTCGTCCTGGTGATTTGCACCC
ATTTGTGCGGGAACGTGTAGATCCTGATGATGCACCAAGCGACTACTACTCGTTGTTTTCGCTTGTCCTAGGCTTTCTCGGCTTTATTTTGAAGGTAAAG
TAATCGTTTATGTTTTTTGGTTAGTCATTTATCTAATACTATGTAAATGTCTAAGTGGAAAGAGATGGCCTGGGGCTCGTTGGCATTGTGCGTGGGTTCA
TTTATCAACATGAAGTCGCAAGACATGAATATGACGCAAGTGGTAAtgtccttcttcttctccacTTCATCCCTCGTGTCCGCATATATGGGCGGTATGA
TACCAATATCCCAGACTATTAAATCCCCTACTTCTTAAGGCAG