Description :
From Genome Similarity Track
Location :
Scaffold_419:52217- 56202
Transcript NameFunction/comments
Aphin_H310_00849beta-glucosidase

Sequence
3985 bases(100 bases per row)
GGATTCGAGGGATTATTTTGATGTGCGACTCATTCCTTCCGGAACTGCGTATTCCGATGCGGCAATCGTACAAGGCCAAGTTGTCTACGCTGGCAACGGG
CTGTACAATGTCACTTACACCCCGTACATGTCTGGGCCGAACACACTGGTGATAGCGATGGCCGTGATTCCTGAAATTCAATCGCTCACGCTGGACTTTG
CTTCGAGCACACAACAAGCGGGAACGTTCACGCTGACCTTCCCACCCACGAACACGACGATTCCCTTGGCATGGGACTCGACCGCAGATGAAGTTGCAGG
CGCGTTGTTGGCCATCCGCGGCAGACCCGTTGCTGTGTCAAGGACGTCGGTGAACAATGGGTTTGTCCACCGAATTACGTTCGTGTCGGACGTTGGGGAC
GTTCCCCAGTTGATCGTGAACAACGATTTGGTGTTTAGCACAGCCTGCGTCGTTGCCACAATCCAGGACGGAACGAAATCGCACATCAAGACATCGTCAA
ACATGGGGCAAGCAATGGTGAATGAAGTCCAAGTCATTCGAGTGGAGTCTGGTGGAGGTACTGCATTGACGGGTGGCAGCTTTACTGTGACGTGGAATGG
TTTGACCACGGGCCTTATTCCGTACAACGCCAACCCTGGAGCGGTTCAGACCGCGCTGCAGCAACTTCTAACGGACTCTTCCATCCGCGTCTCCGTCTCG
GCATCGACGACTGCGTTTGGATTCGAGTGGGTCGTGACGTTTCTCGGGTCCCTTGCTGGCACGGCACAGACCCAATTCTGGTCCTCGGCGAAATACTTGC
AAGGCCAGTACATCCAATCAACAAGAATGGTGGGAAACCTTCCTGTCATGTCAGTTGCTGGCGTCGGTTTGACGGGAGGTCTCAGCCCTCGAGCTTTGGT
GTTTTCAGATGGCATCGTGTCTTCCAATGGCATCACAAGTGTTGCAGGGTCGTCTCCCTTTGTCGTGGCAGTGGACCCCGGAACCCTTGTGGCAAACCAA
ACAACAGCAGTCGACTCAGCGGTGCAATACTGGCCCGGGTCTCTCAGCTCTGTGGGGAAGCAAGGGCTGTCCACCGGAGCGTACAATTCGTTGTCAACGT
TTTTGATCGAGCCGAGAGATGTGCATGGGAACCTCATCAACGTTCGCACGCCACGCCCCGAAGTGCAGATCATTGAAACGTACATTCAAGGAGACAATGG
GCTTGGCACATTGGGTGGCACGTTCACCATTGGATTTGGGGGCGCCACAACGCCTGCGTTGCCATGGAACGCAGGCATCAACGTGGTGCAGTCGGCCTTG
GATAAACTCGACACGATTGGCGACGTCATGGTATCGACAAATTCGGCTCAAACGTTGGTCAATACTGTGAGCGCGACGTACCTTTCGGACACGCTGACGA
CGCCCGACTTGACTGCGTCGTACCAAGTTGGCGACTGGATCCGTCTCGGCTCCACGTCGGGCCCTGTCTTTACGATCGTGAGCATCTCCACTACCACCAT
CTTGCTCTCATCTCCGTACCTGGGATCCACGAACGCAGCTACCAACGTGTACAAACAGACTGTGGTTGGATTCATGTACATTGTTACGTTTGACTCGAAC
GTGGGTGACCTTGCATCCCTTACCGCGGATGCTTCCCAACTCACCGTCACCGGCGGCACGGGCACAGCAATGGCCACAGTTACCGCGTGTCAAGCCCGTC
AGACTCAAGTCATTGCTACGTCGGCTCAATCGTCTATCGGGGGCACGTTCTACGTAGCGTTTCACAACGCTCGGACAGCCGACTTGCCATTTGGGGTCAC
GTCGTCATCGCTGAAAACTGCTTTGCAACAATTGCCAGACATTTACGCAGTCGACGTCGCGGCCCCGGTCGCCGGACCGAACAATGCGTTTTCGTGGACC
GTCACGCTTTTGTCCGTGGACGGGGATTTCGACATGTTATATGCCGAAGGCCAGCTGCTGACGGGGTCTCAAGTTGCAATCACAGTCACGGAAACGTGCC
CGGTTGCTGTCGGTGGTGGCGTCAGCTCGCAGTCCGGATTGCTTGGAGATTACTTCGTGCCACGAATCTCTGGAGCGGCCACGGTAACAGGGTTTGCCTC
GTACTCGAGTCCTGGACAATACGTCGGTGCTTATTTGACCCCACGAACCGGAACGTACCAGTTGGACGTTGTTCACGCGTTTCCTAACGGGTTGGTTGGG
TCGTATTACAACAACCGGTGGTTGATGGGAGACCCCGCAATGACGCGTATCGATGCAGTCGTCAATTTCAAATGGAATGAGTTTATCACTCCAACGGGCA
AAGACTATATCAGTGTTCGGTGGCAAGGGTACGTTCAGCCAGCGTTCTCGGAAGAGTACACGTTTGTCCTAAACGTTGACGACGGTGCGCGGCTGTGGAT
TGACCACACGCTTGTCTTGGACAAGTACGACGTGACGACGGCAACGCCAGTGCAATACTCGGCAACACCGATCTTGTTGGTGGGAGGTCGCTTGTATGAC
ATCACTATCGAATACCGGGAAAATACTGATGCGGCCACGTGCGTGCTGCTGTGGACAAGTGCATCGCAAGATCTGTCTGTTGTCCCCACGCAACGATTGT
TTTACCCTGACGGGGCGATCCAAAAGAGCCCCTTTGCCATTTCTCCTTTTGGTGTGCATCCTACAGCTCCGTTGGCACCGACGCTGTCTATACTGGACTA
CCAGTCGCTTCGCCTGAGCTTTCTCCCACCCGCTGACGATGGAGGGGCGATTGTCGACTCGTACCGTGTCGAGTGGTGGGAGCCTTTGCTGTACGGAGCA
CCTGCGCAACAAACGCTGAAGATTGCCACGTCCGTAACAGGTGGATCGTTCACGCTTTCGATGGGAGCGGGAACTACTGGCCCCCTGGCGTATAACATTG
TCTACTCCGACTTGGAAAAGGCTATCGAAGCATTGGCCGACACCGGAGACTGCACTGTCACCATGACAACCACTGGAACGACGAGAGACTACCTCATTCT
GTTCACGACCAAAGTTGCCCCAGTGCCGATATTGAATGTTGACGGCGCCCTTTTGACTGGCACGACGGTCATTGGTATTTGCGCAAACGGCGCAACTACA
GTGAACGGTTCCCCCAGCACAATTGCAAGCAATGTCATCACATGCGCCGCGGGGGACAGTGTCCTTGGCACGGCGGTGGTTGCAGGATCGAAAACCGATG
TCTCGCTGATGATTGAACCTGGCGCTCCATACACATACGATATATCTGGCCTCACTCAGTCTGCTTTGGCCACACCTCCAACAAAACGTGGCGATTGTGG
AGTAAATGGAGGGTATTCCGTCCGCGTGACTGCCCATACCAGCGCAGGTTATGGCGTGCCATCCGTGGTCACTCAACTGAAGCCCATGGCAGTCCCGAGT
ACTCCAACCTCGGTTGTGTTAAATTTGGTTGCTGGCAAAGCCACAGCATTGCGATTGTACTGGGCGGCGCCAGCCACGAACAACGGCGCCGTCGTCACAA
ACTACATGGTGGAATGGGACACAATCCCATCGTTCAACGGGTCAATTCAGCAATACTCCAACACGCCAGCGTATTTTGCGGCCCAAGTTCCAGCATCCAC
CAAGATGAAGTACACCATGCAGGGGTTGACTCCTGGCGTGCTCTACTACGTCCGCGTTCGAGCAGAAAACATCATGGGACTGAGTAGCCCGATCGCAACG
CCGCTCACGGAGACTCCTCGATTGCATGCCGACGTGATCGACGTCGCTGGGGGGGTGACGTTGAGCGCTCTCGAAGCGAATGGCTTCCACTCTGTCTTGG
ACGCGTCCACATCACTTATGCTGTCATGGCTGCCCACAGTTAACCCGCAGGGTAACCCTGTTACGAAGTATTTGCTCGAGTGGTACGAGGCAGCCGGACC
TGGGACGCAAGAAGTCCAGGTGCTCAAGATCTTTGACACTCTCAACGCCCAAGCTGTCACAGGATCGTTCAAGCTCACGTATGGC