Description :
From Genome Similarity Track
Location :
Scaffold_388:5220- 11115
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_388-snap-gene-0.16Kinesin heavy chain
Pytve_DAOMBR484maker-pve_contig_388-fgenesh-gene-0.9Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_388-snap-gene-0.17Proly 4-hydroxylase

Sequence
5895 bases(100 bases per row)
CACTGACATTGTCGCGGGAACCCACTCGACTCACATCAATCACAAGATGATCGTCAAGAGCGGGTTGCATCCGGAGATCCGAGCGCGATTGGTGGCGCAG
CTCGGTGCGTTGGCCAGCGTTCGAACGGACATTGAGCTAAAGACCGAGTGGGTTGTGGAGAAATCGCTCGAAGAAGAAGAGGCTGAGGAAGCCAGTGACA
GCGATGGCAGTGCGAGCTCCAACCAGAACGCCAGCCAGGAGAACAGTCAGGACACCAAGTCGCCTATGATCGAGGTGACGACTCCGCCGCCGTCGGTCGT
GGATGGCGAAGTTCCATCAGCTTCGCCACCACCTTCAGCATCTGCTCCGACTGATGTGCGGCTTGAGACGCTGCGCATGTACATTGCCGAGATCAAGACG
ACGAGAACCGATTCGTCACCGGCGGTGCCCTTCTCGGACTTGCTGCATCCGTCGCGCCAGCATTCTGGCACGGCGACAAGCGCTCGGTCGTCGTCGACGT
CCTCGATCGCCTCGGCCAGCGCAAACGGTGTCAATGGAGCAGCAAAGCCCTCGTCCACTGATGAGCCAGCAACGTCGACATCTCCTGCCGATCAGGCGGT
GGACGCCGACGGCGAGCCCGTTTACAACCGGAAGCGCGTCAAGTCGGTCACGCACTTACATTTCTGAAGTTGGCGAGAGGTACGGAGGAGCTGCAGAGAT
GCGTGCCGGTGTCGGATACCCGCAGTTGACAATGCGAGAAGGGGGAGGCTCATCCCATGTGACGTAGGTGCGGGGCGGCCAAGAGACAGGAAGGAGAGCG
AGGTCGTCAATGATGGATATAGTATGAGTGCAAGCGTGATTTGGTATCTTCGTTGTCTCCGTGCCCATGTGTCGTTGCGTGTGCGTGTTGAAAGAGGCGG
CAGGCGTTCGCGTCGGCGTGCGTCGAGCCCGCTCACCGCCGCGATTGGTTGCGGCTCGCGGCATTCGCTGTGACGTGGCAACGACGCCGCGTCGACGGCG
CATAGCCACGCGAGGCCACTGCGCAGCCATGTTGCGCATCTCGGGTCGCACTGCACTGGCAGCTGAATCCACTGGCCGCGACATGCGTCCGCATCAGGTT
GTTCGCCTGGACATCAGGTCCACCGCAAGGTTCGACCCTCCCCATTGCCCAGTGCTATCCGATGCTGCCTACCTACATGAATGGATAAAGGTTCTCTCTC
TCGGTTCAACCGTATTGGCAAAGCACTAGTGTATAGATTACGAGGAGCGGAGCAGCTAGTTTCTCACGCTGAGGCCGCCAGCCTCCTTTGAAACGCATTA
AGGGTGGGGGGGACGGAGCACGCAGATGGAGCAAAGCACTTTAGCTCTACGCGGACACGCCGGCGAACTCAGCCACGAACTTGCGCTGCGCCGACGAGAG
TCCCCACGCCGGCGCGCCGCGCACGACGAGCCGCGAGAGCAGAGCGGCCGCGGCCTCGTCCTGCGCGAGCAGCTGCTGGGCGGCGCGCTGGCGGTCGTCC
TGCGACGCGAGCGCCGCCTTCTTCACGTCCCAGGCCTGCATGAGCTGCGCGAGCTGCGTCACGTCCTGCGGCTCGGCGCGCGAGCCGGGGTGGAACGTGG
CCGCGGCCTCGGATCGCGTCTTGATGGAGCCGTAGAAGCCGCCCTGGCCCTCGTACGCCTGGCCGCCCGAGTACGTCGTGAAGGCGCGGAGCGAGGCCGG
GCGAGTGGCGGCGGTGGCCCTGGACAGCAACGTCTTGGCGAGCGCGGGCATGGCTGGAGCTTGGGGAAGACTGGAAAGCGGGGGGACGCCTTACGACTGA
TGCAGAGACGGCAAGATCGGGAATGGGCCGCCGCCGTTTGCCTCACGAATGCCGTCGCACCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGAACCTGTCCATCCTCCTGGTCACAATAGAGCGCCGTGGCACATGCGACGGGGCAGATTCGTCCTGGCTACAGCGGTCAAAAGCACGGCGA
TTTAGGTAAATACGGGATTGAATTAGGGCAACTCGGAGGATTTGCACCGGATTCGAGGGGGTCGCGACGTCATGAAAGGCGGGCGGTGACGCGCACAGGG
TGGCTCAAATCGGAGCTGGCCACGTTGGCGTCATGTGTAATCCGGCAGGAATCTAGAGAAAGCTATATTTTGGCTAGGGCTAGGTCGCTCTGCCCCTCAC
GTGCGTGGCAGTTGCAGTGTTATCGTGCGGCGTACGCTCGCTCCGGGCAAAACAAACAAGCGGACGGCCCTCTCTGCTGTGCTGCCGACGGAGGAGAGCG
CAGCGTGTCGCAGTGCTCGACGAAGCCGTCGTGGACGCACTTGTGGCGGTGGACACCTCGCGCAAGCTCCGGTTGGGAACGCGCGGCAACTGATTCTGCA
TCACGGACTGCATCTCCCGCTTGGCCCCATCCTCCGAAAATGCTGGTGGCAGGGGGCACGGGTTGAGGTTTGGCCACAACTCTCAAAATTGCACTCGAGT
TTCGATTGTGATGGCATACAAAAAATCAAAGTGCACCGCATATCAGCCGCAAATGGCTCAAAACGGACCAATCGTTGCTGATTTCTTCAGGCAAAATTGC
TGATAATTAGAAATAAAATAGTGACAAAGCTTGCTGCCTGTGACTCGATCGATGTAGCCAATCGTCGCCTGCTGCGTCAGAGCTCTCTATTGAGTCAGTC
ACAGTGCACTCGACTTGCCGCTGCTCCCGCTAATCAATTGCGATCCTCGCTGTCAACGAACGCCGCATTGGCTACTGCTCGGATACCCAACGCTGTTCCG
CTGAAGCTCGAGCAACCTTCGCCGCCTCCTGAGCTGCCGCCACGCGGCTAATTCGAAGACTTAGAACCTTCGGCATTCTAGCGCAATGGGCGTATGGAAT
CCATGACCCCGACTTTCATCACTTAGGTACGATTTCGAACGAGTTCGAGGTCGGAAAATGGTAAGTTCGGTCGAACTTCAACCAATAATTGCTCGAAGTG
GAGCATCCATAGAATTATCCGGACATATCGCCGTTAAACCCGTAATTGGCGTCCGCTTGATCGACCATGCGTCCCAGTTCGCCATTGGCATGGCCACCAA
GACCAAGACCAAGACCAAGGCGAAGGCGGCGGCATCTCCGACCGCTCGCAGCCCCAGCAATGCGTCCTCGCGCGCCTTCTCGTCCTGGCGGATGCTGTTC
GTGGCGCTGCCTGCGGCCATAGCGGCGCTGGGCGGCGTCTGGCGCAGCAACAGCTACTTCAACGATGACTTGCCGCGCGTCGACCCCAGGGCCGTGAATG
GGACGCCGCCGCTCATGAACGCGTCGATGGCGGCGCGCAAGTTCCAGGCATGGATCGGCGACAAGCACGCGAGCGAGCTGGTGGATCTCACGACCCCAAA
GCTGTTGGTTCCGGCGGAAGACGGCCGCGAATGTCCATCGTTCAAAGTCGAAGGCGACCTCACCCACATCTCGGACGTGATGGGCGGCTCGGTGCCTGAG
AACCAAGTGTTCTTGATGCTAAACGGACAGAACGAAGGCTTGTTCGTGCCGTGGGAGCCCAACACCGAGTGCTTGTTCGAACTCGCACGGTTCGCGGCCG
AACTGCTCGGCGTGGACGTCGACCTGATCCCCAATGGTCTCAAGCTCTTCTCGCAAGACGGACTTCCCATCACTACAAGTACGCAGCTGAGTGAGCTCAA
GATCGCGCACGTCTTGCTGGACGGACAGTTCTGGGTCTGGCCGGGCATCGTCGTCGGCTACAAGCGCGACATCGAAGGGTTCAACGTCACGACGCAGTCT
CTTAGCCCGAGGGTGTTCACGATCGAGGGGTTCTTCTCGCAGGAGGAAGCGGACGCGGTCATATCAGAAGGCGTCGGCCTGCTCTCGCGTTCCCCCGTCG
ACAGCGTGGATGCAGTGGATGGCTACCACTCGGACCGCACGAGCTTCACGACGTTCCTGGAGGACTCGCAGTTCACGCGTGACATGCGGACACGCACAGC
GCGTGTCTTGCGGTTGCCGGCCCCCGGTTTCGTGGAGCGTCTGCAGCTCGTGCGGTACGAGGTCGGCCAGTTCTTTCGAAAGCACGAAGACTACTTTCAC
AGCAAGGAGTTTTTGCCTCCGAATGAGCTTTCGGCCAAAGAGTACGAGGCGTGGACAAAGTGGGCGAGTGCGCAGATCGAAGCGCTTGATGAACAAGCAG
CTCAGGATCTGCCGGTCGAGTTTCGAAAGGGAGGGGCTATGTTCCCAGACTTTAAAGACACGACCACGTTCCAACAGGCGTTGCTGACTGCCTTCATGGA
TGACGCCAAGGCCGTCAACTTCTTTGAGGAGCACACGGATGTTGAATGGGGTTCGTGGATCACCCAGAACTTGGAGATCAAGGCGAATGACATCATTGAT
CCGCTGATGAAGTCCAAAGGGTACATGCTGCCATACATCATCGAGTCGTGGGAGAAGCGGGCCGGAAACATCCCGCAGCTCAAGTACAGCATCCCTAGGC
GACCGGTGAACGGCGTGACGCACTACTTTCGCTGGATCCGCTGGGCCAAAGAGCGCATCCAAGACGTGCTGGACACGAACCCGTCGCTCGTGCCGGACGC
CGTGGCCCCCACTGGACCGGACTACCCGACATACTACATGAGCTTCCAGAACCGGCTGGTGTCCATGATCCTCGCGGACAACAGCAAGGACAAGCTGGTC
GCGCAGTTCAATGCCGAGTGGTACGACTGGTTCACGGCCAACCGCGACAACAATGACGTGTTGCTCGAGGCTCTGAGATCTAGAACTGACGTCCTCGACC
TCATTGTCGCCGCGTGGACCAAGCGTGCGGGCGACGCTACGTTCGCGTACACCAAACCGAAGCACCTGCACCACATTGAGCCGAATCGGTTTGCGACGCT
CTTCTTGTACCTGAACGACTGTCTCGAAGGCGGCGAGACGGTGTTTCCGTACTCGAAGGAGCGGCTCTTGACGGACATCAAGCGCGACGGGATGGCCGAG
TGCTCGGACGGACTCGCCATACCGCCCATCAAGCTCACGACCTCGATGTTTTACTCGCAGACGCCAACGAATGACCTCGACCCGGCCAGTCTGCACGGCG
GCTGTCCTCCGTCCAAGGGCGTCAAGTGTAAGTAGATGTCTGGTGGGGTGTGCTGCACTCGGAGGTGCTCACTACTGACGTTGACGCTTGTCTTGCAGAC
GGCGCCAACTCGTTCACGTGGAACGTTGATGCCGACGAAGGCGCCAACGCGTGGGACAAGGGCTACGACTACAAGCTGAACCCGGTGTGAGTCGGCGAAC
TGCAGGTGTCCATCGGTTGGAGAGCAGTGTGCTTTTGGTAGCCGCAGCGTTGCGTGTCTGAACACTGAAATGGCCATCGACTTGGCTGTCCGTCAAGGCA
ATGAGATTACCTGTGCATGCAGCTGGTGTCGATGTCAATGGAATGCGGAGTCGTGCAGGAACGACTGCAACAGAGGTTGCAGCAGCCCAAAAGGCTTTGC
TTCGGGATGACGGCAGTCCTCGACAGTGGCTTGGGACTGCAGCGATCCCTGCACGACAGCCCAAGGCGCGGCCGCAGAACGAGAAGCAAGTGCAGTCCGC
ATGCAATAGTTTTCCTCCCGTCCTGATAACTCCTCGGTGGATTGGTCGCAAACAGGCCGCCACTTGCCACTGGCAATCAGCGCTGGCTCACGCAGCACGC
ACTTCGGACGGCAGACGGTAATCCCCCCGCGCATGATTGCTGACCTCGCGCCTCGCCAGTGGCGAACTCGCCACCGCCCGCCCACACCGCTGGCTCGCCT
GTTCGCTCGCCCGCTTGCGCATCGTGTCGGCTGCTCGGCGGATGCAGCATCATCTCCAACCGGCCGCATCGCGCTCGCCCATGCCGCCGAGCAAT