Description :
From Genome Similarity Track
Location :
Scaffold_414:522- 6354
Sequence
5832 bases(100 bases per row)
ATTCCGCTACACCACACTTTCACCGATCAGCCCTATAGGTGCAGGAGCGTTAGACGCAGACGCTCAACCCGAGGGTTTGGTGGAAAATACCCTCGAGGGG
CCAGTAGACACGGTCGTAGATCTCACGGCAGACGGCACCATCCAAGCGATTGAAGTCGATGGAACGGAGGGCGCGGAGGCGGCTGAAGGCTACATTTGCG
GCGAATACGGCTCATTGGCGTCGCACAACAAGTTGCGGCGCATGGAGTTCGTCTCTGAGTCTGATGGCGACCTGAAGGCTGCAAATGAAAGAACGGAGGT
CTCGAACACCGATGTGCTGGCTGCGGGCGAGTTTGTGGAGGCTGTTCCCACACATTGGCAGCGACAAAAGCGCAGCCACCAGAGAAAAGTTAAGGCGGGA
CACTGGGCTGAAAAGCGTTCTCGGAAACGACGCCATCTGCGGTTGTGCGGTATGACAAGGAGCGGTATGGATATATACCACGCGCATTTCATGAAAGCGA
AGAAGGTCAAAGCCATTCTGCGCATTCGAGGGCTTCGAGCACGACTTCGCGAGCTTCGTTTACAGCGACCTACCTACCAAGAACCAGATACGACTGGATA
TTTTCTACTGAGGGAGGTGGCGTGGCCCACCAGCGTCCAGAAAACCAGCGAATCACTCAATCCAGAAGGCGTGGAGTTCGCGGATGTAGGAGATTTTGGG
CGATGCTCGTGCGCAGGTGATTGTTACTTCGATACGTGTAGCAATGCCGAAGCAGCTCTATACTGCACACACGATTCCTGCAACCTGGATGGAAAATGTA
GCAATGCACCGAGAACGTTAACCACCTTGCAGCTGTTTGATACGGGTCGTGTCGGGGTGGGTGTTTGCACAAGCACCGACCTTAGTGTCGGTGACATTAT
CGGCGAGTATACGGGGGTTCTGAGTGCGTACGACCGATCGACGCGGCGGAGCCTGGTCAGAGAATGAAACACAACACCGGATATACGATGCTGCTGAACA
CCAAGTCTCGCAGAAATAAGTACGTGTACGTGGAGGCGTTGAACTGCGGGTCAATGATGCGGCTCATTAGATATTCCTGCACTCTGAACGCTGCATTCGT
CGAGGCTCAGCACAGATCCAGCGTGAAGGTGATGGTACGTATGATTAAAAACGCCTACGCGGGCGCTCAGAACACAGTTGATTACGGTAAGCAGACGTGG
CTTAAATGTGCGTGTGACCAATGCTGGACGTCTCCAGAAGGGAGCGAGGCCACAAGCAATTGAAGTCGTAGCATTCGAGAAATACCCTCGGGTAGATAGA
GTTCTACTTCGATTGGTATGCACTATCAATAACATAGTAGAGGTTTCAATTGCGTTCTTTGACTTCTGAAGAGAAAAAATATGAAAACGTAGCTCAAGCA
CTAATTCAAGAAGCCTTTGCACTAACCCTCAGGTAGATTCTACTCAGGAGGTCTTGGGATGGGACTACATGTACTGACACCGACCCAATTTGAAAACGTT
GGCCTTCTAGAGTGATCGTACAATACCCTCGGGTTCTACGTGTAGCTACAGGACTGTTTGTGAGTATCATGTATATTTACAGACCAGCGAATCAATCCTG
GACGCCTAGAAAGTGAGGGCGGGCCCAGCACTCAGAGGTCTTCCGCCCACGTCGTCTCCAGCTCGCCTGCGTTTGCTCCTGTTCACAAGCACGTCGCGAC
CACTGCTGGCTACGTTTTCTGTGACTCGAAGCGCAAAAAGCACGTGGACGCACACTCCGAAGGCATAACAGTAGTTACAGGGGCACCAACGCTGGGTAAT
ACCGACGGGCCAGCCTCCCCACGGCTGGTTCTGCACTTCCATCCGTGCGTAGTTCACGCCCATTTGTGCGGAAACTGCAATGCCCGCTTCCTTTCTGTTG
TGCAGCGCCACGGACACTCGTTTCGCCAGTTGAGATGCCACCTTTAAGATAGTAGAGCCCCCCGCGTACCTATACTCAGGTATGAGCCCGACGCACACAC
CAATGAGTCTCTCGCGTGTCATTTCTGCGACCCTACGCGTGAGGGTTTTCGAAGTAGAGATGCCGTAGCTTAAGGGCCGAATACTTGTCGAAAGGTCATG
GCAACAAGCCGCCAGCTCGCGAAACAAAGTACCCATCTTGAGTCTGCGGCGTAGAGTGTAGTCTCTCTTAAGCAACGCATTGAAAGTTTCGAAGGGATTG
TTCGTGGCTGCGAAGCCACTCGGAGTTAGGAACGTTTGCCAGGCTCTGAAACGACCATGCAACCACTGTGCTCTCACGTATTGCGCAAAACCCACCAAAC
TTGAATCGGACATCCAATTCATCAACAGTACGTCCCGAAGTTGCTGGAACTCGAAATCGCTTTTTGTAAAATGGAGGTCGTACAGGTCGTACACATTTCG
CACCAGTGCAGCTGTCACACCCGAGGAAAATGTCTTAGTCGACTTCATCACGTTTTTAATGACGTGGAAAAAGCACATAATGAACTGGAAGCCTGGATAG
TGCCCTAAGGCAGCATGTAGAGCGTTATATTGGGCCTGGTCGGCGTCGGCCATCGCGTAGCGGACCCGTAGATCTTTCTGTGTTATCCAATAGAACAACC
GACGTAGCGAAAAGAGAGCTGCCTCGAAGATGGGTTGCGTCTCTTGAGAGACGACGTATAGTGCGATCAAATGGAACCGACGGCTGCGGTCAGACACGCC
AACCACGACAACGGGGTAGCCGCGGCAGTTCATCTTGTATGTCGCGTCTATATGTAGAATGAAATGATCTGGAGACTGCAATAACCTCATCACCAAGGCT
TTGGTAGTTAATCCAACTACAAATGGTTTCCGATCGGAACCGTCGCCGACCACGGGCTTCCCCTCACAATCCAATTGCCAGCCAAATGTAAATGGCTCAT
CCATCGCTTCTGCTCCCGTATAGGCCCTATCGTGAACACACGCTCTGAGCTCGTCCACTCGGTCGTGGTTCTCAAGGTATGTGCGGCTGTAGTGATTCAC
ATAGTTCTGCACCACCCCCAGAGGTGGAAGACTATCTTGCGGCACCGAGAACTTTCGGGAAAGTGCATGGTGAATGCGCAGCGGGCGCACGTGCAGCTCT
GCTAGCTCGCGGTAAAATTCCTTTTGAGCTCCGGTGAGTTTCTTCTTCTTTGGCGAGACGACGTCCTGTTGTGGTCTCCAACGTTGTAAATCGACACACA
CCTCGTGACCGTACAGGTCAGCAACTTTCCGCGCCATGCACACGACGAGCTAGAGCTGTCACCGCACGCGTCCGAGCTACAAACTAGCGGCGATACCGCA
TCTTGTGCGGCTCGGATCCAGGCTCCGTGCAGACCATAGTGTGGCTCTTACGGATGTCGAAATACTTCAGTAAGAGCCACACTATGGTCTGTCTCGAATT
GCCTCGCCCTCGTCCGCCTCGGCGTCTAAGGCGATCTTTTGCCAGAGAATCCGCTTGGGCATCGTCTCCGTTGTAGTTCTGTGGCCACTAAAATGAATTT
TGAGTGCGTCGATTAATTTTTGTACATTCACAAAAATTGATCGACGCTCTCGATTTTGTCTGTGATGCAATGTCTAGCGGCACTCCTATTGGTTAATGAT
AGCTTCAGTCCTTCAACTAAATGCACATCCATAGAATGGGCCCTTGGACAAAGACGACGCATCTATTTGTGTTGCTACCATAATGTGTTGTGTTACAACA
GAGTTAAGGTGCAGCAACAGATATAAAGTACCAAAACTCACCGTGGTGTGTCTGTCACTGTCCCTCTAGCAAATTAGAGTTGCATCTGAACATTTCATGC
AGTGTCGTTGCTTTTTATGGCGGCATTGTTTCTCACTACCCTTCACACTCAAGCAAACAGAAAACAGTATGTGTGACGGGGTCATACAGCACCTTGCGCT
AGAGGAAGTTAGCTTCCGAGAGCTTACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTTTTATCGAAAAGGGAGCGAAGTGAACTATTTAGGGTAAA
ATGTCAACTGTGTATATTTATAGGTAGATAAAGCTTGGGTTTAATACAAACTATAAGTCACCTTTAGAAAAGCAATGTCATCAGCCAATGGTTGGCTTTG
GACGACCTTGGTACCTTGTACCAAATATCCTGAAGTATGACACTTCATGTAACCAGGGATACACTTAGGGCTACGTACCCCGTTACATCCTCCCCCACTT
AGGTTCGGTTTACCGACCAATCAGAATGAAGAAGTGTTCGTCACAAACTTTCATTCTCAAAGTTAAAAAAACATCGACTTGGCCGCGCGAGCGCGGCGGA
GGTTCACTTCACAGTTAGAGCCTCGAGCAGCAGTCTGTGCGCTCTTCTTCTTGGTCTCCACTTCGACCGTTTATCATGCCTCCCGGGACTGCGAAGAGCG
GTGCGAAGACACACTCCAAGGCTGCTGCCGGAAAGGCGCAAGCCAAGAGCACTAAGCCTCACGGCAAAGGCTCGGCACTTCAGGAGGCTACTCAGGTGGC
CTCCGAGGCGATCAGTTCATCGGGTGACGCGGCTGTGGGCAAGCGAACAAGCAAGCGCCGCAGCCCGTCGCCCTCGGCCTCTCCAGACAATCGTCCGAAC
CCTCGGTTCGCTGAACGTGAGTTCGACTCTGGCAGTGAGGACGAAGCCGAGTCCGAGAGCACGCACGATGCTCCTGTGGGCTCTGCGGGAGGGCACAGCC
CAGTGCCCAGCGAGCACGAAGACGACAGCGTGCAGTCGCTCGCTAGTGATCAAGGTGATCACAGTCCCAGGACGTCTGTGCGCTCTGAGAGTCCGGCCGT
CAAGGCTAAGGACACTCCCAAAGCTGGTGGTGATGGGGAAGAGAAACCTCGCAAACGTCTCTCGCTTGCCGAGGGTCTTGCGCGTGCTAAGGTCTCTAAA
GCCGAAGGCGCCAAGCCCTCTAAGAAGCGTTCGGCTTCTAAGTCTCCACTCCGCGAGGACAAGGAGACTCGGTACTCCCATCGGGGTATCTTCGACTCCT
CGGATGAAGAGGAGGAGAAGGAGGAAAAAGAGGAAGAGGAGGGTGCTATCTCTGAGCTTCGAGGGATCACGAATATCCTCGACCAGCAGCAGGAGGACTT
CCAAGCTGCCCAGCGTGTGCGTGGGGTTCGGTGGTGGCACCCATCATCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTG
GGGCTGACCTCTTCCTGGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACCTCTAGGGGCATTTACGAACGTACCCTTGTTCAGAAGAAACA
GTTGTTCGCTGACAACTTGGAGGCGGCTCGGTGTGTGCTTCTCGCGCCACACCGCATCCCTCTTAAGGGCTTTACGACTTGTCGCAAAAAGCCCGAGAAC
CGGGGTGGTCTCTACCCTCTTTGAAGCTACCCCTGGGTTCTGCCCGAGAACTGTCCCACTGGAGTTCTTGTGAGGACATGTTCTGAGCTTGGGTGGAGTC
TCTCAAGTACTCACCCACGGAGTTACGGGAGCTCCATGAAGATCAGCTGCTGTCTCGCATACTGGACCAGCGTGATCTTCGTGTTCGGTTTGCCCACATG
GTCAGCACGCGCATGCTGCCAAGGGACATCCTGAAACGCGCGGCTTCTAGCGCTCATGATGAGCGTGGGTACGGAGTGTCTTCAACGTCCGTACCCCGTT
TGGGCAAGAAGACCCGGACTACTTATGAAGCTGCCGCCACAGATTGCGACAGCCCTACGGGCAGTCAATCAGGAGCCGTTCAATCAGCTCCCACGAGATC
TCGGAGTGGGCATAACCCCTCCACTTCACGAG