Description :
From Genome Similarity Track
Location :
Scaffold_2313:522- 1709
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2313-fgenesh-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
1187 bases(100 bases per row)
TGAACGGGCAGATCGCGAGACCGAACAGCGCGAACAGCACGATCACAGCTGGGAAGGTCTGCGAAGTGCATGTGACACAGTCGCTGGTACCAGTCATGGA
AGAGATGTCAAAAGCCTTGATCAGTACAATCGACGCGACAAACGGGATGATGTACATCATCAAATCCCAAATGTAGTTCGCCAGCCAGAACGCGCCGAGA
GAGACTCCTGACACAAGCTGCTGGTGCTTCGAGTTGTGCTCCGACTGTTTCTCCTTCACCAGGAACACGACGATCGACGCTGGGTAGTACGTGAACGCGA
TCACGATAAACAGACATGCTGTAAAAGCAATGAACGAACCGAACAGCGCCTTCGTCGACTTCGACAATGGCAACGGGTGCGTGTTCACCTTCAAGTCCAC
TTTTGCGTTTGCTGAGGAAGCGCTCGCATCGGAGGCAAAAAATCGATAGATCGCTTGATCCATCAACGCCTTGAAGATCACGGATCCGTGCGTCGCCGTC
GTGTTCACGAACAAGTTGTAGCCGAACAGGTTCTTGCTGCTCTCTCCGTGTACCAAGTACGCGCCGTACTGTCCAGTCACTGCAGTCTGATCAATACCGT
ATCCTCGCTTGTACACCTCCTGACCCAGGCGAAGTCCGTAGCCGGTCGCATCCGATTGATTGATCGCAGGGTTTTTGTAGGTTACGTTGAACACCGTCGG
CGAGTCCGTGTCAAACGCTGGCTGTGGGATCACCGAGCTTGAAATCGCCTGTGGCTCTGCGCCAGTGAAGAACGACGAGCTCATCACGTTGCTGCACCAG
TTGGCTCCCGAGTCGACTTGGCAGTAGAATGGAGCCGGCGTCTCGTTCCCAGAGAAATCGTCCGTCGTCAACGCGAGTTTCGGGTCGTCCTTCGTGATGC
TGCTGCCCTTCAGCAACGACAGACCAGCGAACAGGAGCAGCACGGGGAGAATCGTGCTGTAGAACAGCATCTTCTTGTCTCGCTTCGCCACGCGGAAACG
CTTCAGCACCAGCGCCTTCAGATGCACCATGAACAGTCCCTTCGGCTGCAGGCTCGCAGGATCAACATCGGTCACAGAGCTCGTCGAGCTGGCTTCAGGC
GTACTGGTTCGCACTTGGTTCGCAAGCGTGTGCTGGTTGTGTTCGTCGCCCGCTTCCGCGACCTTGATGAACACTTCCTCCAACGTC