Description :
From Genome Similarity Track
Location :
Scaffold_145:5218- 10462
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19609hypothetical protein
Phypa_INRA-310PPTG_19610hypothetical protein

Sequence
5244 bases(100 bases per row)
AACAAAAATCGCTATCAAGCGCAGCGGAATGCGCGGTAAAGATGCCCGTCACCGGCAGCTAGAAGCGGAGCACACTGTGGCTGATCTTGAGTTGCAATTG
CGATTTACAGAGCAGTCGGACAGTGAACATGAGACCGTTCAAGCAGCCAACGAAGCGGTAATCTTGCGCGAGATCAACGAGAAGATCGAAGAGTACGAAA
TAACTCTGAAGGCGTTGGATGAAGCATCGATGGAAGCTCGAGCTCGGCGCATTTTGTCGACTGTGGGCGTTGATACAGCTAAACAAGAGGATCAGCTCGC
CTCACTGAGCGGCGGTTGGCAGGTGCGCATTCTATTGGCACGTGCGTTGTTCATGGAGCCCGACTTGTTGCTACTTGACGAACCGACAAACCACTTGGAC
ATGCCGTCCATCTTGTGGCTAAAGAACTATCTACTCTCCATGGAGAAGGTGCTGGGCAGTACGTTGACGATCGTACTGGTATCCCACGATAGATTCTTCC
TGAATGAGGTCGCTGAAGAAACGATCCTAGTGCGCGGGCAAGACAAAAAGCTCGTGTATTTTGATGGTAACTACGACTCCTACGAAGAAGCCATGGATAC
GAAGAAGTTGTTCAACGAGAGACTGCTACAAGCTTGACCGAAAGACCGAGAAAATGACCAAGATGGTTGCGCGTATCACCCAGCAGGCGTCTAAGGGCAA
GGACGACAAGAAAAAGCAAGTTGTGGCTGCGAAGAAGAAAAAGATGGAGCGGATTGGAAACGAGCGCAACGACAAGGGCCACCGCTTTAAACGGAGCCGC
GACCGGCAAGGCTTCCATTTTACATTGCTTGACGGTGCAGAAGACACTGCACTTTACGAAACTTCGTACAACAGCAAGGCCTGGGAAGCGTTGACGACGC
CACCCCCGCAGATTCGGAACCTCACAAAGCTCGCACAAACCACTATGCTTTCTCTGGAGAACGTATCGTTTAGTTACAAAGCGGCGGCAGAGATACCCAA
CCAAAGAGAAAACTCCACCTCACCTCCTCTCGCTATCAAAAATGTAACGTTAAATGTGGCGTATGGTGAAAAGGTGGTCTTTGTCGGTCGAAACGGAGCG
GGTAAGACAACACTGATGAAGATTCTCAATCGAGTTATCAAACCGGATGCTGGTAAGGTGCAGTATTTCCATGGAGCACGTTTGGGGACTCTCATGCAGC
ATCACGTGGAAGACTTGAAGCGACTGGAGTCTCGCAATCTCAACGCGTTGGAGCTGCTAATGAAGTCGATCAGTAAGGAAGAAAACTCGCCCGAGGTGTT
GCTCGCAAACAATGGAAATTCCAATCGAGGCACCACGTCACTTGAAACCAAGGTGCGTGCGCACTTAAACAAGTTTGGCATCAGTGGTGAGACTGCTGTG
TCCGTGCCGCTGGGAGGGTTGTCTGGTGGCCAACTTGTTCGCGTTGGTCTAGCCTGGGTAACGTTCCCGAATCCACCCCATGTGCTGCTACTGGATGAGC
CAACGAATCATCTCGACATGACCACTATTCAGGTGTTTGGTGAGGCCCTGCGCAAGTACCAAGGAGCGGTTGTGTTGATTTCGCACGATATCCATTTCCT
CAACATCCTAACGCGAGAACAAGGCGGCAAACGCCTCAACGAAAGTGATAGCGATGGCGACAAGGATGAATCGCACCCTTCACTTCCAGCACGCGTATTC
GAGGTCCGAAAGTCCAAGGGGATCGTGTCTGTCCATCAACTAGAGGGCGGTGTGGACGCTTACAGACGGAAGCAGGAACGGATTAGCGCGTCGGTGGGGC
GAGTGTAGGACTGGTAGTAGTTAATTAATTCAGACCATTTGGCAACGCTCGCTCGCTAATTCAAGGGATTTATTAATTAAACCACCACTCGCTCGAAACA
CGGCAGCAAACACTTCAACAAAAACCATATGTTTTTGTTATGAGTGAAGGTCTTAACATGGATACACCTGCTCCAATTTGTAAGCACACCGTACAGAGTC
GTATCGTCTTGATGGAGGTGGAAGGCCGAACAAGCACTCAAATGAGGCTGTACCAAGTTTTGAAAGGATATTGTCGAGCTTCAGTGTTTTCCAATATCTG
TATTCTAGAAAGATTGGCAGCAGCGGAAAGAAGCAGGCTCACCTCGAGAAGTGAAGTAGACTATAAAATTAAGGCGACATGATATATCCAGCTGACCAAG
GAACTGTCAGTCTCGTCGCGACTTTCGCCGTTAGTATTTGGGAGTTGAGATGACACCGTTGATGAAGAAGAATATAGTGGAACACCCTGTGCCGGATTTA
CTAATAGTGCAGCACTATTATACAGGGATGTCGTGATTGCGTACACTTAGATCGGCTCATCCTGGCGACTTCGCTGGGGAGCTTTCTTTTAGTGATCCAG
TGGTTTTTACCTACAATCTGTGTCGCAACTACTGCATACCTAAGGTTACGGTACGCTTTCGGACTGATGAGAGTACGGAAGAAAAATTATGGGTGTACAA
ATGACTGTACGTTTCTGGTTTACGGGACGTCTTCTATAGTCGTGAGTAAACACAAGCTGAAGGACAGGCACGAGAGTAGAGTGTAGACGTTCTCCATTTT
GACACGAACTACCGAGCTTTCTCTAACCTCGGTATTATGTGACACAATCTTTATTTTAACAAGTATTAGGATACACTGGGAGCTCCAGCCAAATGTACCA
CTTTACGAGTCACACGGATACAAATTCCCTGTTATTTCGGAACGGCTCAACGAGTGTATCTCCTCGTACTTAAACGACTCAACAATCAACCGTAGTTTTT
AGCTGGTTTGGGCAAACCGGACATTTTGATTAGAGCGAATAATAGGTGGAATTTGCGTTTACTAACGCTAGCATGTTGCCATGAATGCAATGTCAGCCTC
AATAACTTGAGGACGGAGCTACATGCATTATAATCGGCGATATGCTTCGCCATCAAAAGTCAAGCTGCATGTATTTCAAAGCAGACTCGCGCAAGATTTT
GAGTGTCGCATTGCTCACAGGCGCTTGCGTGAGTACTGCATCCCGTCAATTTGACGGCGTCAACAACACGAACAATATTCCAACAGAACAGGCTGTTTTA
ACCCTTTGAGACCTGTAAATGCATGAGCAGCAATCGATAGCATTTTGGCTAGAAGTCAACGAGAAGAATACCCCATTGCATACAAACAAGACTAAAGTGA
GAGGTTAATGAGGATTGTAGTAGATTGTAAAGTTTTTTTTTACTTAGTATATATAAAAGTACTAGAATATACCATTTAATAATGCGCACATGTGCGGCAC
ATGATGTACTTGCCACGCAGGAGGCTACATACGGTTGATCTCGTCTTCAAAGCCATAAATTGATTTTCTAGATTACTTATCACTGTCTGCACGAGTGGAC
ACACCACTAAACCCCGTCAAGTGCTCCAAACACGTGGGCATTTGTTCTTCAGATTACGGCCGGTCCGAAGGTCACATTCGTATGATTTTTAGTGAAAATT
CGACACTTCGGATTGAGCTGTGAATGGAGATACAAATAAGGGGGTAGAGTTTTTAATAACAGCTGATGAGTGCAAGGCTCTTGTTTGTGGCTCTGTAGTC
GACCACTGGAACTGGTGTTCACTCTGCAATACACAGTTTATGTAAAACGCATCCGAAAGTTGGATTCAGAATACGGCACCATGTAACCGTGTCCGACCTA
TTGTAATGACACCTTGCTTCTACACATACATTAGAATCAACACCGGGTCATATAGTCTGGATAGTCCCTCAAGGGCCTCTCGCTTGCGAATGTAGATATC
GTCTGCAAGGACGGTCGCTTCGATTGCTGTCACAGAGAACAGCTCCGTTGTCGTCGCAAATGCGAGTTGTTAAGGGGGGGGGGGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN