Description :
From Genome Similarity Track
Location :
Scaffold_1691:5217- 7496
Transcript NameFunction/comments
Phyta_totarag13510hypothetical protein

Sequence
2279 bases(100 bases per row)
CTTGGATACACACCTTGAACTACTGCGAGAAATACATCGTCGAGTGCCTGTCTGACTTGGACAACACCTTGGAACCGCTCGTTAAAATGCCGGTCGCAGA
TTGGTCGAGTCAGCTTGAGCCTACCGGTACCTGGTCCACACAATTCGCAAAGTGAGTTCGCGATTGGTCAGCAGTCATGAGGCACTTGAATCCAGTCGGA
ATTGGCTATGCTGATTCATGTCAGTCGCCAGCTGACGAGATGATGCTTCTTGATACGCCACATGAAactgtcagtattcgaagATGCTGGCTTCTCCCAG
ACTCGGAGTCTAAACCGGATCAAATTAGTCTGAGCTGAGACTCTCAGACTCCTCAGCCCAGGTTTTGTTTTCGAAGTCAGTCAGGTTGCGTCCAATGTCA
AGCCAGTTCTGATCGAGGTTGCAGCAGAGATGAGGGGTTCCACTATTGTCCACTAATCGTCCATCGCAGCCAGGGCGATAGTCAATTTCAGGTAGTCACC
CAATGGGTTTGACATGATTTTGCTTCCACGGCCCTCGTCACAACCGTCCCTTATGTGGCCCGAGTCCAATGATATCATTCTCGAGTTGGCCTCAGCGCGC
ATAACTGGATAATGCCTGTGATCACCTCACCCCGGCCTCGTCAGATTTTGCCAAACCTGTGGACTATTGTCCCAGTCCATTTGGCAATACCCAACGGAGC
ACGCAACCAGCGCTCTCAGCATCCCAGAACACACTTACACTTCGATATGGCTTACGACAGATAGTCCGGCCAGTAAATCCCAGCTCCACCGCAAGGTGAC
AACAGTCACGGTTCCGTGTCACAGGGCACACCTCGGGCACCTGCGACATCGGTCGGCGAAGCGACAGCCTCCGGCAACGTCTCTGTGGCTTCCGCAAGTT
CCAGCGCTAAGCTCACAGCTTCTGGCAGCGCGACGGTCAGTGCTGGTCTGCGTTCGACCACGCGCGCcatgtcttcagcttcagccgCACCACCAACAGT
CTTCGCCTCGTCACAGTCAGGCATGACATCAACACCTGTGTTGGCTCCGAACGTCTCAGCGAGTCGGCCTTCTTCGTTGAGCGGTTCACAATCACACGCG
TCTCCCACATATCAGCGGCGATGCTGATGCTACAGGCTACCTCGGCAAGCGCGTATGCGTTGCCACCCAGTCCGTCGTCACGTTAAGCTCAACTGGCTAC
TGTTAGGTAGTATGCTCACGTTGGCACCAGTACAGCACAGCCTATCACCGCGCGTATCCCAGCTTCGTTCGAAGATATGCGTCGGGCAGAGGTTCTCGGG
AGTGAACCAGATTGGCTTGCCCGCTTCGTCCGTATGACCAGCTTCTCAGACTGAGTTGGTTTGGTTCAGCTCCATTGTCGACGGGAATGCTGCGCATGAT
CTCATTCGCCCGGCGGATTCGTCACCGGTTGACATCTCCGATGTTCACGCCCGCATCGTCTTGGAACGGGAGATGATCGTGCTTCAGTGCTGAGCAACTT
GTTCTCCGCGCATCGAACGCCATGCGCTATCTGTGATCAACTCTGAAGTACCTGGAGATCATTGAGCATCAACTcggaagcagctcgagcgccGCAGATG
CCGTTCGTCTCAGGGAGTGTCACGCTATCGTGGAGAGCACGCGCAAACAgggcgaagatgatgagACGCAAGTCCAGGATCTTCAACTCGCCCTCGCTCG
AGAGCTAATGGGTACTAGGGCTACTAGCTCTTTTGCCACTGAGATAAATGCCGAGCTTGATCAGGCCAACACTACGGGTGTGTGTCTGACTACTCAGAAC
TTGGATCTGACGAGTGCTCTCGACCGTGCCAAGGCTGAGCTGTAAATAGCTCATACAGATTTTCAAGACAGCAGACAGCGCGCTACTGAGCTCAAAGCTC
AGTTCATCAACGCACCAGCGTTTTTGCCAGAAGCACTGATAGACTTCTTGAATGATGACGTGGCACTGCGTGGACATTGGCAGCGGCTATTAGATTTGCT
CCCGGCCTATCAAGAGAGACGGGCAACTCCTCTAAGTCATTGCACGACTCTCACTATTTCAGCTCGTGACCAAGTCACCAACGACCGCGGCATATAAATC
CCTCAATCCACCGAAGCTCCTGCACCAAGCCCGCGCAGTTCCGTTTCCCAAGTCTTATCTCCACTGACATCTCGGCCTTTAATCCCTGCTCCAACTTACG
CCTCAGCGCAAGCTCGTACTCTACTCAGACTAGCTCGTGTTAGTCCGAGGAGCTCGGGAAAGGAATGGGGGGAGCCTTT