Description :
From Genome Similarity Track
Location :
Scaffold_1:52169- 55231
Sequence
3062 bases(100 bases per row)
ATGGACGAGAGTGTCCTTGATGAGAAGACTCGGATTGAGCGATGTACATCCCAATCGTGGGAATCTCTCAAGACAAATCCTCTCTACGATGATTTGATGG
AATTTAGGGACGTATTTTTCAGAAGCAATTCCGTGCGAGTTACCTAAGGACAAAGGTACTCGTCACGAAATCAACGAAAAACCGGGTTCAAAGTACTGTG
TCATGAAGCAATGGCCACTGCCCCGTGAACAAGTACGAGCGATCGACAAGTTCTTTGCCGATCGCTTGGCTGCGGGTCATGTGAGGGAGTCCATCTCTGC
ACATAGCTCTCCGACCTCCTGTGTTCGAAAATCCACAGGAGGATGGCGGATAGTACATGCTTTCAACAAGTTGAATGCTGCAACTGTACCGGCTCAAACA
CCGATACCAAGAAAGGATGTCATTATAGATGTTATGGCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGGTTCTATCAGATCCTTATGCGTG
AAAAGGACATTCCTTACACAGCAGTGAGCACCCCAAGCGGTATGCTTTGGGAGTGGTTGGTAATGCCACAAGGGCTGAGTAATGCCCCTGCTACGTTCAA
TAGATGTGTTACGAATCTGTTGATATATGTGCAAGAATTCGCACCTAGCTATTTCGATGATGTGTTCTTTCATAGCCGGGCTATGGATGGACAGACGGAA
TTGGAAGTTCACCGACTCCACGACCGAAAGTTTCTTACACTGATGCTTGAGCATAAGTTGTACGCCAACCTCAAGTGGTGCATATTTGCTGCAAGCGAAA
TACCACTTCTTGGATGCATCGTGGGTAACCATGGCGTCCGGTTCGATCCGGAAAAGATCAAGGTGATCACTGACTGGCCAGTGTCTACCGACATAAAAGG
ACTTCGAAATTTCCTTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAGAACGAG
AAGTGGGAATGGAGTGCCGATTACCAGCGCTCTTTCGAAGTTATCAAGCAAAGCTTGATACGATCGCCGGTTTTGGCAATTGCAGACCACGACAGGCCAT
TCCACGTGGTCTGTGATGCCAGCGACTTCGCAATCGGCTGTTCATTAATGCAGTACGATGCAGAAGATGCGGAACGTGTCGTCTGTTATCAGTCACGCCA
GATGCAACCTGCTGAACGCAATTACACCGTCCATGACAAGGAAATCCTTTTCATTAAGTACGCGTTGGCTAAGCTCACAGTTTCTGCTAGGTGATAGACC
CTTCATCGTTTATACGGACCACGAGGCTGTAAACAGTCCACACCTCTCGCAGCGGATGGCGAGGTGGCTGTCATTCTTTGCGGGGTACAACTTTTCCGTC
GAGTATAAGCCAGGACGACTTAACGTCGTCGCTAACGCACTCTCGCACGGGCCCGATTTCGAACCGGCTGCGACTCCAAACCCTGGTCCGACCACTATCG
CGGTACTGACTTCGAGTGTCCCGTAGTCAACCTTGTTGGAAGACATACGAAAGGCGTATGATCCGGGAATGGTGCGATTAATGGATCATCTCTCGCATTC
ATCCAAGAATAGTTTCAAACAGTTGTCGTCAGTATATCGGTCCTCTACGGATAGATATACAGTTCGCAACGGCTTACTCCAATATTCGGCTGTTGCCGGC
GACATACCTCGTGTCGTCGTACCAGATCATGGTGATCAGCGATTGCGTATCATGTATGACTACCACGACGCACCTGTTGGTGGACATCGTGGTCGTGAGA
AAACATATCTCACAGTGAGCCGCGACTTTTACTGGCCCCGCCAGTATCAGTTCATCCGCAAGTAAGTCTGCGCATGCGAAGTATGTCAACGAGTGAAGTC
TGGTTCTTCACTTCGTGCGCCGTTGCAACCCTTGCCCATTCCGGCAGAATGCTGGGAATCCGTCTCAATGGACTTTGTTTTGGATTCCCTGGAGACTCTC
ACAAGAATACTTGTATTCTTGTGTTCGTTGACAGGTTTAGCAAGATGGTACATCTGGTTGCTGTACCCTAATCAATCAACGCATCGGCTTGTGCCCGTGT
CTTTATCGACATAGTCATTCGCCTTCGTGGGTTGCCTCCTGAACTCGTGTCCGATTGGGACCCGCGGTTCACAGCTGAGTTCTGGCATTCCGTGTTCAAA
ACACTCGGAACGCGCTTAAGATGTCCCCGTCTGACCATCCTGGTCAGACAAAACGCACCAATCGTGTCCTCAAAGAGATCCTCCGAGGGTACGTCCATTC
CTATACGAATTGGACTGAATTCCTACAGATGGTGAATTTTGCCATCAACAATTTTGTCCATGCGTCGACGACGCACACGCCGTTCTTCGTGAATAGCTTA
CGCCATCCGCTTCTTCCCACCTTTTTAAATTGTGACTCTATTTTAAGGGGGGAGGGACTCATTCGAGCGACCGCCAATCCGGCATTCACTCGTCACGTGC
TGATAATGTGGTCACCACGTCCTACGACGATGTCGATCACATCGACGTTGGTGAAGAAGAGGAAATTAAGAGCGAAGATGCTCTTACTGACCACAATACT
GATCAAATCAGCACCAGGCCTAGTGCGTCCAAAGACACACTCACCGAGGCAACAAGTGATCTTGCTGCAGTACGCTCCAAGAGCACTGCAGCTAAAGACA
GCGAGTCAGCAGATGAATTCATACTGGCTCGCGAAACGATTGTCCGTTTCGTACAAGAATCTATCGCAGAGGCGGTAGATCGACAAAACCGAAACGCTTA
CAATAATCAAAGGGCAAATGTTCTTTTATTCAATAAAGGCGACTTAGTCCTACTATCTACGGTAAACTTACCTCGACACATAGTGACTAGCGTGGGCTGT
AACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCTCCAGGGCAACGCATATACAATCGAATTTCCACGTAAGATGCGCACGCATCCTA
CCTTTTGCGTCGGTCGCCTTAGGCCGTACTATCAGTACGGAGCTTCTTCCGGTGAAGGCAGC