Description :
From Genome Similarity Track
Location :
Scaffold_184:52165- 53362
Transcript NameFunction/comments
Phymu_g6282hypothetical protein PHYSODRAFT_524421

Sequence
1197 bases(100 bases per row)
AGGGCGACGACGTTGTCGCCAGGCTTCACCCAGCCGAACTGCTTGCCCAAGTCCGTCGCGCGGTACAGGATCGAGTCCGTTCCGATCATCGAGCCCATGC
AACGGGCCCGCACACCCTTGTAGAAGCCCTCGGCTTGGTGTGCGCTGCCAGCCATCGCCGTCAGCACCAGAATCGGCATCGACGGACGGAACTTGGACAC
TAGGCGCGCCGTGTCGCCTGACTCAGTCAGCACCACGAtcatcttggccttgatgtCGATGGCCGTCTTCACAGCCGACGACGCGATGGCCTCCTGCGTG
GACATGGGCCCGTACGTGTCCAGAACGGCGTTGCGCAGCGACTGGTACACGTCGTCGTAGCGGATGGCACCTTCAGCCTGCACGCAGATCTTCGACATCA
TGGTGACGGCCTCCGTCGGGTAGTCGCCGTTAGCGGTCTCGCCCGAAAGCATCACGGCGTCCGTGCCATCAAGAACggcgttggccacgtccgTGCATTC
GGCGCGGGTCGGGCGCGGGGCGTTGATCATCGACTCCAGCATCTGCGTGGCAGTCACCACGGGCTTGCCAGCAATGTTAGCCTTGCGAatcatcatcttc
tgcgCCAGGAACACCTTCTCAGGCGGGATCTCCATGCCCAGGTCGCCACGGGCAACCATGATGCCGTCCGTCTTGGCCAAGATCTCGTCGAAGTTCTCCA
GACCCTCGTGGGATTCGATTTTGGCAATAATTTTAATGCCACGACCGCGGGGGCCCAGCACTTTACGGATGTTGTCGATATCCTGGCCCGTGCGCACGAA
TGACGCCGAGATGTAGTCGACGCCGTGCATGAGGCCGAAGTTGATGaggtcgtcctcgtccttctccgtTAAGGTCGGCAGCATCACCTTGCAGCCGGGA
AGGTTCATGTTCTTGCGCTCCCCGAGCGTGGCCGTGTTGTTCGCGCGGGTGACGATGCTGTCGtccttgatctccagcacaGTAAGCACCAGCGAGCCGT
CGGCCACCAAGACGGTACCGCCAACCTGCACGGACTGGGGCAGCTCCGGGTACGAGCAGGCGATCTTGGTCTCATCGCCAAGGAACTCGTAGTCCGTAGT
GAGTTCGAGGATGGAGTCCTTCTCGATCGtcaccttgtccttgttgGCGAGGAAACCCGTGCGGATCTCCGGGCCTTTGGTGTCCAGCATGATGGCG