Description :
From Genome Similarity Track
Location :
Scaffold_48:52160- 57503
Sequence
5343 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGGGATGATTTTCATCCCACGCATGAAAGCTACTCCCA
TTTGAGTTAGATCGAATGGGATGCTGTCGAACGCTTGATTTCAACGATAGGGCAAGAAGCCGTTGACGCACTGCTGTCCGCCCTGGGGCCAGACGGACAG
CACGCCACCATCGCCAAGTTCATTCAGAATGAACTTGACGCCGAGCGGGAAAAAGTAACCTTGCTTCACCAACAAGGTTGTCAACAGTTTGAACTGTTGA
GACAGCAGCAGACCACTGCTACCGGGTCGACGTATACACGTCGACGCGAGACTCTAAAGATTGACATCTCAAAGTACAAGGGAGCCAATGAAGACTCTCT
ATTGAGATGGTTCGTGGAACTAGACGATGCCATAAGGGCTCGTCATATCGTTGATGAGGAAATGCAGATCGCATTTGCTCAATCGAACTTGGCAGGGCGT
GCAAAGACGTGGGCCTTGGGTCTTAAGTTACACGACCCACATGTCTTTGGGTCGTTGGAAGTCTTCAAGTCCCTGCTAAGGCAAACCCCTGAGCCGCCGC
GAGCTAAGTTTAGGGCTCACTCTAAACTCCTGAGAATCAAGCAAGGTAAACGTGACGTACACTCGTACATTCAGTACATACGTCACGTTACCAGTTGCGA
CCCACTGAAATAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAATCTACCTGCTCCAATTGGAGTTCAACACCCTAGAA
GAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAAACAGGCTCACGCGAATTTGAATTCCTATCGTCCATAGAGACGACAGGAAAATGGAGGCC
CAGAACCAATGGACCTCTGTAACGCGAGGAGCGGGAGCTCTCGTGTTAACAACTATAAGAAATTGCAAAAATCCAATAGATGTTAGAAGACAGGGCATTA
CGCATATGAATGCAGTGCCCCGGGCGCGGTACCACGTACCGCAGGGAACAGCAACTGCCAAGCGGCCAAGAGAGGTCCAAGGCGTGGGTCCGACGTTGTT
GTGAAAACGCAACAACGTCGGACAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGGAGCACCCTACTGATCCAGCAACTTTGAGTGAGTTTGCAGGCCTCT
TGACGAAAGTTGCTCCCAACACTCAGTCATTATGTGTTGCTGCTTCTGGTAATGAGGTTTTCCTCATTACCTTGAAACTCGAAGTGACACAAGGCATGTC
GCTTCGAGCGCTAGTCGAAAAACTTTGTACGACGCCAATCGCTAGACAAAAGACAGCTCGAATATGTTGAGCGAGAGATCCCTCCAACGAGGATGACGGT
GCGCCTCGCGATAGGCGCATCCGTAACAGTGATGAAACGTATTACCTATACGCTGAAGGGAGTCCAACATAATGATGACTTCATCATATTAGACTTGGAT
GACAAATTTGATGTCATCCTTGGACTGCCGTGGCTCAGAAGGTACGAGCCACAAGTCAGCTGGCATCGACGAACAGTCGATATGCCTGTCACTTGTTCAT
CAGGTGGCCATCTGATCAACTGATCAACGCCATGGAGCGCACACTAACATGTGGGAGTACTACGAGCGAGTGCGATAGCCTCGCGTGTGGTTCGGCCGTT
AGTACGACTGTACATGGCCATGGTGTGGCTGATCACTACGCCATGAAGTCAGATTCCGGCGACTGCATTGAGATGCAGGTCGCTCCGAAGGCCCACCACC
CGAATAAGTCGAGTGGACTGGCGCATTGGTGTCCTTCAAACGGACAACACCCAAGTGAAATTGAACCGATTGCCAATGATCGGCAATACGATGATCTTAG
TGCGATTGGAGAATCGCACGTAGAAGACCTGGCCGTGGTAGCGCAACCACCGCCAGAGGATAGCGAGGAAGCAATTCCACTCGTGTCAGATGATGAGATA
GCCATAGAGGCTAGTGAGGGAATAAGTCCCCACCCAACTGTGGAAATAAGTTCCCAGGAGACAACAGAGACATTAAATGTCCTAGTCAATGACGGATCAA
GTATTGGCACTTACCAACTTGATCTGATTGCGCCTCCGAAGACAACTTCGGAGATCACTCAATTGCTCAATTGCCCACACTCGAACAGAAGAGGTTCTTG
CGTGACTGCGTAGTGGAAAGGTAAAGCAGATTTGCGTACTCGTCTTCCGCGACGAGTACGTAACCGATATCCGATTGGCAATAGTCTTTGCCGAGGACGA
AAGATCTCTCAGTAGCTCATTAATGAACGAGAGTGTCCTTGATGAGAAGACTCGGATTGAGCGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAAT
CCTTTATATAAGGGTTTGATAGAATTCAAGGACGTGTTCCCGGAATCCGTACCATGCGAATTGCCTTAGGATAAAGTCACTCGACATGAAATCGAGATCA
AACCGGGCTCGAAGTACTCTGTCATGACGCATTGGCCACTGCCTCGTGAACAAGTACTTGCGACCGACAAGTTATTTGCCGATCGCCTAGCAGCCGGCCA
TGTGAGGAAGTCCACCTCCCCACATAGCTCTCCGACCTTCTTTGTGCGGAGAGCCACAGGAGGGTGGCGAATAGTACATGCCTTCAACAAGTTAAATGCT
GCCACTGTACCGGCTCAAACACCAATACCAAGGAAAGATGTCATGATAGATGGTATGGCTAAAAGTACCATATTTTTTCATTCATGGATCTGATGGAACC
CATCCATCAGATCCTTATGCGCGAAAGGGACATCCAATATACTGCATTGAGCACATCAAGCGGTATGCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTA
ACTAATGCCCCTGCTACGTTCAATAGATGTGTGACGAATCTGCCAAGATCCGCACGAGAGTTCGCGCCCAGCTACTGCGACGATGTGTTCGTCCATAGCC
GGGATATGGACGAACAGACGGATGTGGAAGTGCACCGACTCCACGTCCGGAAGGTTCTTACACTATTGCGCAAGCATAAGTTGTACGCCAACCTCAAGAA
GTGTATATTTGCTGCTAGCGAAATACTACTTCTTGGTTGCATCGTGGACAAGCATGACGTCCGGCCCGATCCGATCCAGAAAAGATCAAGGCGATCACTG
ACTGGCCGGTGCCTACCGATATAAAAGGACTTCGATAGTTCCTTGGTCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCA
TCTCTCTCGTCTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGCCAGCGCTCTTTCGAATGTATCAAGCAAAGCTTGATATGCTCGCCAGTT
TTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCAAGTGATTTTGCCATCGGATGTGCACTAATGCAGTATGACACAGACGGTGCTG
AGCGTGTCTTCTGCTATCAGTCACGTCACCTGCAACCGGCTGAACGTAACTACCCAGTCCATGACAAGGAACACACGAAGTACGCTTTGGCGAAATTTAG
GGTCTACCTGCTAGGTGATAGACCCTTCATCGTTTACACGGACCATACGTCCTTACGCACGGCCGTTGACAGTCCACACCTCTCGCAGCGAATGGCGAGG
TGTCTGTCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATATAAACCAGGACGACTGGATGTCGACGCTGATGCTCTGTCGCGCCGGCCCGATTTCGAAC
CGGCTGCGTAACCCGACACTGGTCCGATCACTGTCGCGGTGTTGACATCGAGTGTCCCGTCGTCCACCTTACTAGAAGACATACGCCAGGCGTACGATCC
AGCGATGGTGCGTTTGATGGAACATCTCTCGCAACCATCCCGTAAATCCCTTAAGAGGTTGCCCCCAGTATAGCGATCCTCCACGTATAGATATACAGTC
CACAATGGCTTACTGAAGTATACAGACGTTGCCGGCGACACGCCTCGTGTCGACGTACCGGACCATGGTTACCTGCGACTGCGCATCATGTATGCGTACC
ACGATGCACCTACTGGTAGACATCTTGGTCGAGGGAAGACATATCTCACAGTTAGTCGCGACATTTACTGGCCCCGCCGGTATCAGTTCGTGCGTAAATA
CGTCCGCGTATGCGAAGTATGTCAACGAGTGAATTCAGGTCCTTCACTTCGTGCGCCGTTGCAACCTTTTCCCATTCCGGCATAATGCTAGGAATCAGTC
TCCATGGACTTTGTATTTGGATTCCCCGCAGACCCACACAAGAATACAGGTATTCTTGTGTTCGTCGATCGATTCAGTAAACGGTACATCTGGTCGCTGT
ACCTGAATCTACCATTCATCGGCATATGCTCGTGGTTTATTGACACGATCTTTCGACTTCATGGGTTGCCTCGTGAACTCGTCTCTGATCAAGACCCACG
GTTCACTGCGGAATTCTGGCGATCCGTGCTCAAAACACTCGGAACGCGCCTTCGGATGTCGACCTCTGACCACCCTGAAACAGATGGTCAGACAGAACGT
GCCAAACGCGTTCTTGAGGAAATCCTTCGGGGTCATTTCCATTGGCTTACGAATTGGAGCGAATTCTTGTCAATGGTAGAATTCGCCATCAACAACTCAG
TGCATGCATCGACGGCGCATACACCGTTCTTCTTCAATGGCTTGCGCCACCCACGCCTACCCACCTTCTTAGAATGTAACTCTAGTTTGAGGGGGGGGGG
GACTCATTCGAGAGAACGCCACGTCGGCTCTCACTCATCACGTACTGACCACGAGGTCACTACGTATGACGCCGATGTCGATCACATCAACTTTGGTGAA
GACGAGGAAAGTAAGAGTGAGGATGCTCTTACTACCCAGGTCACTGATCTTGCCACAGTGCGCTACAAGCGCACTACAGCCAAAGACAGCGAGTCAGCAG
ATGAGTTCATACTGGCTCGCGAAACGGTTGTCCGTTTCGTGCAAGATTCCATTGCAGAAGCAGTGGACCGACAAAAGAAAAACGCAGACAAGAATGGAAG
GGCAAATGTTCGTTCGTTCAGTGAAGGTGACCTAGTCCTACTATCTACGGTAAACTTACCTGGACACATAGTGACTAACGTGGGTAGTAACAAGTTACTA
CCCAAGTTCATCAGTCCATTTCGTGTGCTGCGCCGCTTAGGCAACGCATACACGATTGAACTGTCACGTAAGATGCGCACGCATCCTACGTTCTAAGTCG
GTCGCTTTAGGCCTTATCACCAGTACGGGACTTCTTTCGGTGA