Description :
From Genome Similarity Track
Location :
Scaffold_482:5215- 6366
Transcript NameFunction/comments
g9071.t1hypothetical protein
g9072.t1POM74471.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
1151 bases(100 bases per row)
TCGGCTGAGCGAGCGCAGAACCACGGCCACATGCTTGCGGCCAACGGCGCCCACCGTTGTGTGATATCGTAGCCCACCGTTGACAAACTCATGCCATTTC
AAAGTGTGGAAGTTGGAAGTGGGCGTGATGGTGGATGCAAACCCCATGCCTCCAGTGTTGCCATTGTCGCCCCCAAACGTCAAGTGCTCTGCCACTTCGT
GCAGTTTGCGCTGCGGCGCGAAAACGTCTTCACACGGAAGCGGGAAGAGGAAGCCGAATTGTACGTGCTCGGCGCGGTCAAAGAGCGCCGAGTCTACGGC
GTCTATCCAGTGGATAGAGCGGAACTCGATCCGCAGTCTGAGCTCGCACGCACCCGGCACGTCTTTCATTCGGGAAGCAGCTAGTGTACCCACTGAAGGA
GCGCGGAGGATCATGGGGTTGGCATCCGTCGAATTGGCGTTCCACAAGCCGTCTTCCGCAAGAAGGGATACCGGAGACGCTTTCTGCAGCGAAGCCAGCA
GTACTACCTCGAAGCGAGCTGATACCGGCTTGTGGTCCGACGAGGTCACAGCCTCGCAAGAGTCATAGGACAAACAGCGGAGCGAATCCTGCATGCCTGC
GAGCGAGCTATAGAAACTCGATTCATACCAGTGGTCGGACAATTTAGTATTGCAACATGGTTTAAGCAACAATTTAATAATTGCAATACGAGTCGGGCCA
ATAATAAATAATTACTCGGGTGGAAAGTTTTGGGGTGCCAAACCGGAGTCCGCTTTGATCCCGCAGGTTATTTCCTTATCATGTGGAGATGATATCGACC
AACCAAAGGCCTTCGCTGCGCTTGGCTATGTTGTTAATGACCAATGAGGGCCCGTCTTCGACGGCTCGGATTCTTTCTTGCGAATCGGAGCCGCCGTCGC
TATCTCTCGGCAGCTGGGCGACAGACACTAACGGACGGACCGGTTCTGTTGAAACCCTCGGATCTAGCGTCAGGATCCGGGGGTGTGCCGCTCAGCTGTG
ATCTGAATGGCGAAGGGTAATAAGCGATAGCTAAATATAGGCTAGGGACATTGCAGAATCTCAATTTCCATTATACTCTGAATCGTGCACTTCTAACAGG
TTTTGAGCCCAAATGCAAGCGGAGCCAGGTCGCGTAAGGACCGGCTCCAAC