Description :
From Genome Similarity Track
Location :
Scaffold_53:5214- 10753
Sequence
5539 bases(100 bases per row)
CCCATTACTTCCGGTAGTACTTTGTAGTCCGTCCAAGGACCACAGAACCCGTTCAACATGAACATATTGGATGACGAAGGCGAAGGCACCTTTCACGGCA
CCCGTGAAAGTTACTCCTATTTGAGCGATGTTGAACGGAGTGCGGTCGAACGAATGAGTTCGACCGTCAGCGAAGAAGCTGTCTGGTCTCTGCTATCCTC
AAGGGATAGGGACCAACAGCATTCCGTAATCACCAATTTCTTGCAGCAAGAACTTGACGCGTCGCGAGCTAAAGTGACCCTGCTGCATCAGCACGGTCAC
CAGCAGACTGAGCTCCTGAGACAGCAACAGTCTCAGTCTGCTACTACAGCCTCGACACATGAGCGTCGACGCGAGACTCTAAAGTTAGAAGTCTCCAAGT
ACCGGGGAGTCGAGAAAGACTCCCTGTTAAGATGGTTTCCCGAAGTGGAAGATGGCATTAAGGCTCGTCACATCAACGACGAGGAAATGCAAGTTGCATT
TGCCAAATCGAATTTGTCAGGACGTGCCAGAACTTGGGCCTTGAATCTTCAATTACACGATCCAAACGTGTTTGAATCGTTGGCGGTCTTTAAGACTCTG
CTCAGCCAAACGTTTGAGCGGCCAAGAGCTGAGTTCAGGACTCTTACAGAAATCCTGAAGATAAAAAAGGTAAGCGTGACGTCCACGCTTACTTTCAGCA
CGTTCGTTACCTTGCAAGTTACATGGTAGAGAATCCTGTAAGTGAACTCGTGTTGATCACGATATTCTTACACGGCCTCATAGATGGTCCCGTGAGGAAC
CGCCTATTCCGCATCGAGTTGAAGTCGCTTGAGGAAGCGATCACAACTACGGTGCAAGAGGACTTTAGTGTAAGACAGGCTCACACTAGCTTCACCCCTA
TCGTCCTTCGAGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGATCTTTGAAGTGTCGAGAGCGAGAGACATCGCTCTTCAAACAGTAAGCAATTGAAA
AAGTGCAATCGCTGTCAGAAGTCAGGACACTACGCCTACGAGTGTAGTGCTTCACGCCCAGTGTCTCAAAACACTGAGCAAAGTGATCGACCGTCTGACA
GGAAGGGCAACGGACGCAGATCCGACGCTGTTGCGAAGTCACAACAGTGTGGCGGACCGTCAAAAACCGGTCAGGGTCAGTAAGGGCGGAGCGCCCTACT
GATCCAGCACCTCAATAGAATTTGCAAACCCATCGATGAAAGTTGCTCCAGACTCACAATCCTTGTGTGTCTCTGCACTTGATGATGAAGTACCCCTCAT
CACCTTGAATTTAGAAGTGACAAAATATTTGTCACTTCGTGCCTTAGTTGACTGTGGGCGTCGAACAACTTTGTTCGTCGCCAGTCGCTAGAGGATCGTA
GGCTCAAGTTCGTTGAGCGCGTTACTCCTTTTACGAGGCTGACGGTGCGCCTCGCAACAGGCGCATCGATAGTAGTGATGAAACGTGTAGTGGGATATTC
ACTACACGTTAGAAGGTTTGCAGTACATTGATGATTTCATCGTACTTGATTGGATGACAAATTTGATGTCATACTAGGGTTAACCTGGATCGGAAGGTAC
GAGCCAAGGGTCAGCTGGCAGCATCGAGCCGTGAAGATGCCTGCCACTTGTTCATCAGATGGCCATCTGATGAACGTCTTGGAGCGTCCACAAGCGTGTG
GATGTAAAGCGAGTGAGTGCGATGGCCTCACTTGCGGTACGGTCATTAGTACGACTGCACAAGATCACAGTGTGACAACCAATCACACTGTGAAGGAAGC
TGCCGGTGGATGTGCGGATGCACAGGCAGTGCCAAAGGTCCACCACTCGAATAAGTATAGTGGATCGGGACATGGGTGTACGCCTAGCGGGTGACATCCA
AGTAAGAAAATACCAGTGCCCACACAAGGCAATACGATGATCATAGATCAACTGGAGAGTCGATCGTAGAGGACCTAGCTGTGGTAGCGCAACCACAGCT
AGAAGACGTCGAGTGAATGAGTCCCTATGTACTTGAGGAAGAAATTCCTCAAGCAGATATTGGTGAGGTAACGAGACCTCATCATCCCGAGGGAACAAGT
CCCCATCAGCCTGTGGAAAAGGGTTTTAAGAAAGGAACCGAGACATTGAATGTCTTGGTTAATGACGGGTCAAGTGTAGGCGCTTATACACTTGATCTGA
TCGCGCCTCCGAAGTCGACTTCGGAGATCAGTCAATTTCCAACGCTCGAACCGAAACGGTTCTTGAGAAATCTGCGTAGTGGCAAGGTCAAGCAGATCTA
TGTACTCGTCATGGAGGACGAGTACGTGACTGACATTCGGTCGGCAGTAATATTTGCTGAGAACGAACGGGTCTCAGCATCTCATCGATGAACGAAAGTG
TCCTCGATGAAAAGACTCGGATTGAGAGATACACGTCTCAATCTTGGGAGTCACTTCAGTAAAATTCTTTATATTTGCTGAGAACGAACGGGTCTCAGCA
TCTCATCGATGAACGAAAGTGTCCTCGATGAGAAGACTCGGATTGAGAGATACACGTCTCAATCTTGGGAGTCACTTCAGTCAAATTCTTTATATAAGTA
ATTGATCGAATTCAAGGACGTGTTCCCTGTATCCGTACCATGCGAATTGCCTAAGGATAAAGGCACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAG
TACTGTGCCATGAAGCAGTGGTCGCTGCCTCGTGAACAAGTACTTGCGACCGAAAAGTTCTTTTCCGATCGCTTAGCTGCGGGTCATGTGAGGGAGTCAA
CTTCCCCTCACAGCTCTCTGACCTTATGTTTGCGCAAGGCCACAGGCGGATGGCGGATAGTGCACGCATTCAACAAGCTGAATGCTGCCGTCCATGGATC
TTATGGATGGCTTCTATGAGATTCTAATGCGTGAACGGGACCTCCTGTACACGGCAGTAAGCATCTCGAGCGGTATGCTATGGGAGTGGCTAGCAATGTC
ACAAGGGCTTAGCAACGCCCCTGCCACGTTCAATAGATGTGTTACAGATCTGTTGAGACCGGTGCGAGAATTCGCACCGAGTTACTTCGACGATGTATTC
GTCCATAGCCGGGCTATGGGTGGAAAGGAGGATGTTGAGGTTCATAAAACACACGTTCGTCAGGTTCTTACACTTATGCGCAAGCGTAAGATGTACGCCA
ACCTCAAGAATTGTATATTTGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAATACGGCGTACGCCCTGATCCTGAATAGATCAGGCGATC
ACTGACTGGCCGGTGCCAGTCGACGTTAAGGGACTAAGAAAGTTCCTTGGTCTAGCGGCGTACGTACACAAGTACTCGCGCAACTACGCCGAGATGACGG
TTCACCTCTCTCGTCTTTTGAAAAAGAATGAGAATTGGTCATGGGATGCTGATTGTCAGCGTTCCTTTGAACGTATCAAGCAGAGCTTGATGCAATCGCC
CATCTTGGCGATTGCAGACCAAGACAGACCATTCCATGTTGTCAGTGACGCCAGCGACTTCGCAATCGGCTGCGCGTTAAGGCAGCACGATGCAGACGGC
ACAGAGCGTGTCGTCTGTTATCACTCGCGTCATCTGCAAGCATCTGAGCGTAATTATCCAGTGCATGACGAGGAACTCTTTGCCATGAAGTATGCACTAG
CGAAGTTTCGCGTCTATCCCCTTGGAGATAGGCCGTTTGTAGTCTATACGGACCATGCGTCATTACGCACTGCCTTAAACAGCCCACACCTCTCGCAAAG
GATAGCGAGGTGGCTATCCTTCTTTGCGGAGTACAACTTCCCCGTGGAGTACAAACCTGGACGACTCAATATCGTCGCGGACGCGTTGTCGCGCCGACCC
GATTTCGAGTCGGCTGCGTAGTCCAACAGTGAGATTGATACCACTGTTGCAACACTAGTCACTAGTGTTCCGTCGTCAACATGCTTGACGACATAAAAAA
GGCCTACGCAGAATATAAGGCTCCTCTGCGACTTATGGATCATCTGGTGACTCCATCTCGTAAATCCCTCAAAGATTTACCGGCCTTGTATCAATCTTCC
GCGGATCAATACACAACACGCAACGAGTTGCTATATTATACAGCCGTTACCGGCGACACACCTCGTGTATTCGTCCCCACTCATAATGATTTGCGCTTAC
GCATCATGTATGAGTGTCACGATGCACCAACTAGTGGGCATCGTGGGCGTGGGAAGACTTATATCACGGTAAGTCGCGACTTTTACTGGTCCCTCCAGTA
TAAGTTTATGCGCAAGTACATTCGTGCTTGTGAAGTGTGCCAACGGGTGAATCCCAGTCCTTCATCCCGTCGCCACTACAGCCTCTACCAATCCCGCCAG
AGTGCTGGCAGTCCTTTTCAATGAACTTCGTCTTCGGTTTCCCAGAAGACGATCAAAAGAATAATGGTATTCTTGTGTTCATAGACAAATTCAGCAAGAT
AGTACATCTTGCTCACTTAATGAGTCAATCTCAGCACATGGTTGTGCCCGTGTCTTCATTGACACGGTATTCCGACTCCACGGTCTACCCCGTGAGCTAG
TCTCTGATAGAGATCTTCGGTTTACGGCGGCGTTTTGGCAATCCGTGTTCTGATCCCTCCGAACACGTCTGACTTTGTCTACTTCTGACCATCCCGAGAC
TGATAGTCGGACAGAACGCGTCAACCGCGTCCTCGAAGAGATACTTCGAGGATACGTCCAATATTACACAGATTGGAGCGAACTCTTACCGATGGTTGAG
TTTGCAATCAACAACTCCTCGCATGCATCGACAACGCATACACCATTTTTCGTGAACGGCTTACGCCATCCACGCCTATCCACCCATTCAGGGTGTGACA
CTAATTCAAGGAGGGGAGGGATTCGCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATCACGTATCGAGGTACTCGACGACGCTGACGTTGACGATGTCGA
TCAAATCGATATCGAAGAAGATAACCTCAGCGATAGTAGCGACACTATTGCTGACCCAGATGAGGATGACGATGCTGGTATATTTAGCATCTCCAATGAC
TACACTAGCGAGGATGAGAACACCCTCGCTGAAAAGATGATGCCCCCTAGGGGGGCGCACAAGGCGCACTGCAACAAACCAAAGTGAATCAGCAGACAAT
TTCCTGCTGGTACGAGAAGTAGTGGTCCGTTTCGTGCAAGACTCCATAGCTAACGTTGTGGACCGACAGAAACGGAACGCTAACAATCATGGAAGAGCAA
ACGTTCTTCTAGTTAATGTCGGATACTTAGTTCTACTGTCTAGTAAATCTACCTAAGCACGTAGTAACTAATGTGGGTAGTAGTAAAATACTACCCAAGT
ACATCGGCCTGTTTCGAGTACTACATCGCAAAGGCAATGCGTACACGATCGAGTTGCCTCGCAGGATGCGTACGTATCCTACGTTTTATGTCGGTCGTCT
CCGCCCGTAACATCATCACGAGTTCTCTTCCTCGGGCGA