Description :
From Genome Similarity Track
Location :
Scaffold_34:521352- 527129
Sequence
5777 bases(100 bases per row)
GGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATATGCTCGGAAGCTAACTCCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCAC
TCGTAGTCAATCCACGCCACCGCGAGTAGACTACCTGAACCTCTCCGATGTTCGTTGCCATGGATACGAACGACTTCTCCCATATGAACGACTCTCAGTT
CGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAACGCCTTC
GACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGACTGAAGG
CTAAGCCGTATAAAGGGAAGGAAGGCGAGAACCTTACTTCTGGGCCCAAGAAGTAGCGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAATTCGTG
TTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCAAAGCGTTGGGTGTACAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCT
GAGCCGCGTTCCTCCCGCGTACCGCCAGCGTTCGCGCTTCCTCCCGTGCAAACAAGGGAGGCGTGAGCTGCACGAGTACGCGCAAGAGATACGGGAGCTT
ACGGCGTCCCTAGTGAGAAACCCACTCAACATACACTGTGCTCATGGACGACCTTCGAGTGGGCCCCACACGCACTCAGCTGTTCCGGGTGCAGTCAAAC
ACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGCGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCGGGGAGTTCCTTGTCGGCTC
CCGATCGAACAAGCCCAACGGACCAGCTCCCATAAAGCTCGTGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGAGAAGATGAGCCACCTCAAG
CGCGACTGTTTCGCGGAAAGACTCCGCAGAAGGTCCTTCCCCAAGCCCGCCCTCAAGGGTCGCTGACAGAAGCCAGGATCCCGGGGACAGGGGAACGCCG
GAAACCAGTAGGGGTGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGAAGGGTGCGCAGGTGGCGCATATCACGGGGACTTAGCCCCTGAGAGCCTT
CGCACTCTTGAATCGGCGAAGAGCAGCGGCGGGCTGCTCGTAGTACACGGATATGTAAGGGGATACGATCATCCCTTTAGAAACTTGATCGATTCTTGGG
CGTCGAAGAATTTCGCACGCCGCCAGACAGTTGCTCGTAATAGCAACAAGTTTTCCGATGCTTTGAGAGAAAAGCAAGGGCAACGGGACGGTGTCAGTGC
GACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTTCAAGTGGATCTGACCGTCAAGTTTGAAGGCTTTGACAGCCTCGAATAGTTCACTGCTCTTGA
CATGGGTCCGTACGATATGGTCCTGGGCATGCCCTGGCTTGAGAAACACGAGCCCCGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCG
CAGTCCGACAGAGCATTGGTGAGTCATGTTTCCACCTCTGTCAGTACCCGGGGCGCCCACAAGAACTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGG
GAGTCGTCGACGTATACGATGACTCCGAGGATGTTTTGATGGTGACAGCGCCCAGAGGAGGCGCTGGTCAAGTGGGTAAGTTAGGTCCACACGCGGGTCA
CTTAGTTCCGCAGACAGCTGCAGCTGTCGCGAACACTGACAATTGTGTGTTCAAGATGGGTAACAGAGTTCTACACACGGTCGCCCAGACCTTAACTGAA
GAGGAAGGCGTCGAGCACGCTTCCTGTGTGGGTACCACAGTAACACACGAGGCCACGAGTACCTCGGATGTCGGAGCGCCGACATCCCCAGGCGTAGTAG
TAGAGCCCCACGTCACGGTCGCCGACGACGACGAAGCCGCCGCCACAAGTCGGATCCGAACTTCGTTCAGATCAACGTCGCTTCAAGCGACTCGGAGTCC
AGGGCCCGGGCTCCTCCGACAAGGCCGGTAGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCCTCTGGTGTACACTTGGAAC
CGTTTCCAGAGGCTGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGACCTACTTCAAGGCTGGAAAGGTTGCTGAGATGGTGCTCAT
GAGACCTGAGACCAATCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGAAGAGAACGTCCTGGAAGATCTAAACAAGCAGCGTTAGACGCGCTTGTGTTCT
GAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTGGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAGCTCCCACCGGATCGAG
GTGTACGGCATGAGATTGTTCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTT
CGCCACAAAAGCGAAGGCAGGCATGGTGCGAGAGGCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGATAGTGGCGTCTAGTT
CATGCTTATAACAAGCTGAACAACGCGACGATGCCGGCGCCAACACCAATCCCACGAAAGGCTGTGTTGTTAAACAACATGGCCGGGAGCGTACTGTACA
GTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTGAACACTCCAAGCGGCATGCTTTGGGAGTG
GCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACATTCAATCGCCTGGTGATGCAATTGTTCCGCCCTTTGTGTACCTTCGTACAAACGTACTTC
GACGACATATTCGTCCATAACCGTGCCGAGGGAGGCAAGACAGCCATGGATGTGCATCTAGGATACCTCCGTCGAGTGTTAGACGTAATGCGAGCAAACA
AGCTCTACGACAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGACGTTCGGGCTGACCCAGACTA
GGTCATGGCCATAGCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGGGTACGCGGGCTTCG
CTAAGCCCTTGTCGGGCCTCCTTCATAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTGATAGCATTAAGGCCAGTCTCCAATAGGCC
CCTGTCCTGGCCCTGCCGGACGAGACGAAGCTATTTAGCATCGTCTGCGATGCCTCCGATTACGCCATCGAGTGTGCATTGCTGCAGGCCGACACGGCTG
GACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGAGCTCCTGCCAATGAAATATGCCCT
TGCGAAGTTTCGTGTTCACCTTCTGGGCTCCCGTCCCTTCATGATCTACACAGACCACGCATCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAA
AGGATGGCGAGGTGGCTGTCTTTCTTCGCGGAGTACACCTTCCGCGTCGAATACAAGCTGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTC
CTGACTATGAGTTGGCCCACATCACACGGGTGACAACGGATCAATTTGATCGGATACGCATGGCGTATCGAAACGATGAGGCTGTCGCGCCTATCGTCAA
CTTCCTCACGGCAGGGACGGGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCTCTCACGGTTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTAC
CGGGTGGAGCCCAATGAATCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAATTAGATATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCC
ACTTGGGGCGCGAGAAGACCTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCATGGGTCGCCCGATACGTTAAGACCTGTGAAACATGTCAGCGGGTC
AAACCCGCAGGGCACTCTTCGGCTCTACTACAGAGCCTGCCCGTACCGACTGACTGTTGGAAGTCAATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCG
ACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTCCCGTCACTGTTACGGGCGAACAAACCGC
AAGGATGTTCGTTGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGAACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAAAGCTG
TTTCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGACCAGACAGATGGCGTCAATCGAGTGCTCGAGGACACTCTGC
GCAGTGTGTGCGCGGCGGCACCACGTACGTGGACGACGCAGCTTCCAGTTGTTGCGCTTGCGCTTAGCAACGCGGTGCACGCGTCCACGGGGCTCACGCC
GTTCTACTTGAACAGCTTCCGTCACCCCAGCGTGCCTCTCACTCTTCGAGGAGACGCTGACTCCTCTTTTCTAAGTGGGGAAGAGGCTAGGAAAGCCCTT
CCCTCCCAGGTCTCGGATGTAAGACCAGTTTCGCTGCCGAAACAAGTGGAATCATTTATGGATACCAAGCTGAGCATTGTCAACAGGGTCCGCGATGCCA
TGGCAGCGGCCCAATAGACAAAAGGAGTACTCGGACAAACATGGAAGAGGACACTTAAGTGTATTTAAAGTGGGGAACTTAGTGTTACTAGACACGAGGA
ACCTGCTGTAGTGGTGGGGAATTGGAAAGTGAATTGATGAATTAGACTGGACTAAAGACTGAGAGTGCACTATGTTGAACTAAAGGAGCGTATACGTCAA
CAGAACCTACCTCTTCACACTGTCAGCTCTGTCGGCAGTAACATGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGT
ACACCATCGACCTGCCTAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTATTTTGATTCGCGGGGGGGGGAAGGGGGTTGCTG
ACTCACAGACCCACCTTGGCCCAGCTCCTCAAAGCGAGAACGGGCCACAGACGTCGACGAGGGCGTCGGAGCAGGCGCCCAAGCCTCGGTCTGGACGGCA
AAGCTGCGGTCAAGACCGTACGCAGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCCGGGTTCGCACCATGCGCGT
ACGTCTGGGAGTGCGTCGAAGGCGGCTCCGGACGTGGCAACCGAGCCTTGATCCGTCGGAACATGCGGAAGGCCTCGTTCAGATCCGTCGAAAGGCCCGG
CGATCCACCCGCAGATGCAGGCTCGCTACCTCACGCTCCAGCAGGTCCAGGCGGCCCGCAAGCCGAGCGAGCTCGCCCTAATTTCCGGCCCGGGCGGCAG
CATCATCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCATGAGGACACGTTGACGGAGGCGGTCAACCGCAGGTTGC