Description :
From Genome Similarity Track
Location :
contig_110:52124- 59027
Transcript NameFunction/comments
g13217.t1hypothetical protein

Sequence
6903 bases(100 bases per row)
TGAAGAAAGTGCTATAGCGACCGCAAGTCGTGCTAGGGCTGCTCGAAGGCTTTCAGGTCGCCCAGACACGTAATAGGCGAGTATGAAGAATGCACGATTT
ACACCATTTCATACTGTAGTACGATTTATAGGTATCTTGTGCAAGACAAGCCCCAGCACCCACATATGTGCCATTTTATTAAACTCGGCAACCTGCCACG
TCACAGAACCGCATTCGTCGACAGTGGGACGTTCCCAGTAACCCAACCACGCCCTTACCGTCAATCGGGATCAGCTCGGAGGATGATCTCTCCGCCGCTC
TTCGGGTCTGGGGACAGGATTCTCTTCCGGATTATCCTCAAAGCAGTGTCAACATTAACACCCAGTTGGCTCGAGAAGTATGCGAGTCCACGCCGCGTAT
AGGCCAAGCATATACCCATGACTGTCTGCGGACAGTCCGATTTCGACCCCATCGTCGCCTGTGACAACACCACGACGGCAACGCTGCGTTCGTCAACAAC
GGCAAGTTTGAGAGAATAAACAGGTATTAGATAATTTGTGAACGGCATCGCTTCCATTCCTTGGTGATCACAAGCGTCCCTCACTCCCGAGGACGGATCT
CATCGCGGTGAATTATTCTGCACATAAGATTTTGTCCGTTGTTTGGCTTTAAGCCATCAACGTTGCTGTTGAATCGACACTTTCGTCTATTACATGTATA
GCAGATTTGCAGTCGCGTTGGGGGCATTTTTGCGGTGCTGGAGTGCTTGTGTACGGTCAGTAAGTCTGAGTGTCCTTAGCGTGGTTTACAGTCTCTATCT
ATGGTGCTGTTTTTCAAATCCTTGGTGCTGACATGCCGCACTCTTTTTTCCAAGGGGTTGGCCTTGAATCAAGGATCTTGATGACGCCACCTTACTACTT
GAAGTATTATCTAGTTTAGCACTTACCCGCCATCCAATACTATCCGAGCGGAGCCAGCAACTGAAATGTCGTGCCAGTAGCGAAGCTCTCCTTCTCGCAG
CTACACCAGCTCGTTTGAGACACATGTGTGTCTACCTGTAGTGCAAACCAAACTGTTGATTGAGGCTGTAACACTGCAGCAAAGCAACCTCGTGCACTTT
GAAGGTGGACACGTGGATACGCTGCCACAATTTTAGACGCGACCATGATGCTATCGAAATTAGCCATCGTTAAGTCAATCTACGCATGGCAGCCACACAA
GAAGATCATCGTCAAGTGCTGTTGCGGTAGATGGGGGATCTGCGAAAGAGTTTCACAAAAGCGAACGGTATACTACCGGGAGTGGATACGAATCCAGTCT
CAGAAGGGGTGTAGGTGTTTGAAGAGCAATGAACCGGAGGCTACTAGCAACAAACCCGGACGGCATTTACGGAGGCCAGCCCAATGTCCAGTTTTCCAGC
AAGTCGAGAAATGCCTCGACCCGAGTTTACAGACATTTCTCTTGCAGGAGCGTTGCGCGTGCGAAACGGAGCTAAACCCTGAACTGTATCATTCCGTGAG
ATCGTCGCAACAGCTTTCTGTATACCTTAGTCAAGCTAACTGTGGTTCCATCCCATCTCGATGATCGTAGTTACTCATCTGAGTTAGTATCCCGGATGCT
CCTGGGAATGCCATCGCATTGTGCCAACGACGATGCAGCAACAATTTTCAAGATCCAGGTTGCGTAGGATAGCAGCGTGCTGAGCAGCCTCCTGCCTTCA
TTCCAGGGTTGGACGTTGGCAGTGAGTGTATCAACTCATTTAATTTTCACTTTCAAATCTGCTGCCCAACCCTCAAGTCCCCAATCCCCCCGACCATACG
CATGTGTCTATCTCACATTTTCGTGGTGATCGCGGCTACCTTCCTGCTTGCTAGCGCGACGCCCACGGACTCCAACCAGGCCAAGATCGTCCAAGCGACT
TTGCCGGAAGGCCTGAGCCAGCGGCTTCTGAGGACCTACCCCACGACCTATGAAGACGACGATTCCGAAGAAAGAGGAGATTTCACTAAGGCAGAAAAAG
CGTTGTTTAAAGCCATGAGGGGCAATGGCAAGACCGCTGACGACTACGCTGAAGAGTTGGGCATTGCCGCCGCCATGAGGGAAGTGGAGCGTACCGGAAG
GGGGGTGCACAAGCTCCAGCTAACCCAGGCGTACGGGGACTACGTCAAATACTACAACTACTTGAGGTCAAACAAAAACAAGTAGACAAAGTCTGCAGAG
CAAGCAAGCAAGCAAGCCGCCGCAAGCGTATCACGTCAGCGTCTGGCCTCGAACCAATTGCGGGTAGATTGTAACTGACGATTGATCCTTAATAGAGTGT
CTATCATCAGAAAACATGCATTTGGTGTGTGGCATTTGTAGAGAGCCAGGGGAATATTGAGAGAGGGATGTGAGTACACAAGATTTGGAATACAGCACCA
TAATTTTAGGTGTCACCACTGTAATGCTAGACGCCAGCACCTTAGCAATGGACAGGCTTCTTACAATGAGGCACTCTGCCTAAAATGTCTAGATGCTATT
CGTTTGGGCTAGGGACCGATCGTCAAATCGGTACCTCAAACAGCACACTGAAAGGCCAATTAGGCAGACGTATTAATGTTGGTTTTAGTATGCAATGTGT
TAAGTACGATATAGTGCAGCCTAACTGACCCCTCGATTTCACTAATGCGAAACGACTGGGCTAGCGATTTCGTCGGCGAGGGGAACTACGCAAAAGAACT
GCCTCGCTTGAAGCTGGCCCTCCAGTGCATAGTTGCTCTATTAGCTACGGTGTCAGCTTTTTACCCCTTTGATAATACAGCAACCGCCTTCAACAGTGTG
TGTGCTGGGAGGAATTGAAGCAAAGACGAGCACGGACGATGCCAAGGTGCTGAACTCCTAGCCAGTATCTAAGACCCTCCAAGCATCAACTACTTCGGAC
CTTTCGGATCTCTCCACGGCCGATTTGAACGAGTTGTCGCTCTCGAATTTCTGTTTGAACTGCACATACTGACTCCAGATCTTACTACACGCAGCTATGT
CGAAGTACTCCTTCCACTTGCTACCGTGCGCCAAAGCAAGCTCCCAGAAGCTTGACTCATTATTATCAATGATGGCTTTGGGTATGATGGGTACCGCTGC
CGTAATCTCGCTGTTTACTTCGATCTGAATGCTTTGAGCAATCTCCTTGTATTGCCGACAAAATGTTGTCACGATTTTGAAGGTGTACTCATGCATGACG
CGGATGCAGTCGGTGTAGCCCCCGTACGCGATGGCGCCGTCCGTATTGCGATACTTAGAGTTGTATGCGTCCAGGCAGTGGCGGCAGTAGACATCCATAC
CGCTGATGCACTCTTTGCAGGGTTCGTTCTGGAGACAACGACGCTGTCTCGCTGTAACGGGGTTACACGTACCCGTTAGTGTACGGTACACGCATAGTGT
GTTTTTCACACAAACGGTGTGCACACCCAAGTTGGTGTGGGTACACGAGACTTAGGTTGGTCCACCCGTCATGCATATTACTAGGCTCTACTATGGTAGA
TAGTGAGTGTTATACATTTACCCCACTGGCGGCCTTGCCGCGAATAACAACAATAAAAATCAGTTCACGTTTTGAAGTCTAGTGTCTATTAGCCTTATTT
AAGGTATTAATAACTCTAGGAGTCTGTAGATCGCATATCTACAGACTGTACTTGGTTCTGGTATAGAACCTAGGTCTACAACCGAACTAAGACTCGGAGA
GTCTACGTCTTCCTCTGACGCAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCTACACCTGAGTCTTACGACTGTCCCTCTGTGAG
GATGGAGCAATTTGCCCACTTACCCCCGAACCAACAGGACGGGCTTAAAAAGCTGATGTCCTTGTTGGGCCCGGAAGGTGTGGCTCATCTTGCTTCGCAA
GGCCCCGACGCGATTAATGCGCGTCTGGAGGCGTTCTCGAGTTATGAGAATGCTCTGTTGGAACATCTACAACAGAAGATGACGGCTGTGACAGCGTCTA
CGACGCCCAAGCCGGCATCGGATGGAGCTCCACGAGCTAAGCCGCTCATGGTGAGCGTGAAGACCTTTGAGGGCAAGGAAGGAGAGAATCTCCTGCTCTG
GATTAGAGAGGTCGAGATGGCCATGGCGTCCGCCATACTCCAGACGGAGCAACAGCGCGTGGCGCTGGCCGTGTCCAAGCTGGGTGGCCGGGCCCGGGAG
TGGGCCCTAACGTGTGGCACGTCGGTGGACAGCGCGTTCCCATCCTGGGAGCAGCTGAAGCTTCAGCTGTCGCGAGTGTTCTCGCCGCCTAACCAGGCCT
ATCGCGTGCGATCACGCTTCCTGGCTACCCGCCAAGGAAAGAAGGAGTTGGTGGACTTCGTCCAAGAGTTACGAACTCTTATTGCCGGTATGGCTGCGGA
CCCTCTTCCGGAGGCGGTCACGGTGACCATCTTCATGGAAGGCCTCCGCACTGGCGTGGCCAGAACGGAAGTATTCCGAGTTCACCCCACCTCTTTTGAA
GAGGCAGTGAGCGTGGCGTTGAACGCCGAGTTCAACTTTAAGTCGGCCCGAGCCGGGTGGGGAACGTCGCAGACGAACTCATCCGGAGCCGCCGGCTCCT
CGGGTGGCCCGAGCCGATGGATCTCAGCCATGCTGAAGACGAAGAAGCTGAGCTTCTTGCTGCCGAGCAGCGCATCGGCATCCGCCGGTGCTTCGTACCC
AGCACCTGCGACCAGGTTGCCCGCTGCGTAAGCAGCGCCAGGCTCCGGCGAGCCGAAGCCCTGCTTCTTACCAGAAACCTGGTTCGTGGCGGGGAAACGT
CAACGCTCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTAAGTTCTGTTGAGCCTCAGCAAGGAGGTCAGCAGGGCTTAGCCCCGAAGAGCACCGTGC
TCTTTAACACGGAACGTGTATGCAAGCCGGGCTTGCTGGTCGTTGAAGCGACCGTGAAGGGCTTTGATAAGCCGTGGACGATATTGATCGATTCGGGAGC
GTCGGGCAATTATGCTCGACGCTCCACGATGGAAGGAAGTCGGCAGTATGCCGAGGCGCTGGTAGCGCGTACGAGTGATATTATCACTGTCCGTCTCGCG
ACGGGAACCCGCGTTACGGTGCCCAAGGTTCCTGTGAACCTTGGCGTGAAGTTTCTGGACTTCGATAGCGTTGAACGCTGTCTGGTCCTTGACCTGGATT
CGAGATATGATCTCATCCTGGGCATGGCATGGCTGGAACGCCATGAGCCATGGATTGATTGGAGGTCTAAGACCTTAGGCGCTACGCGGTTGCCTCCTGG
TGAAGCTTTGGCGAGTCATGAACCCACCTCTGCTAGGAAGCAAAAGCGCTATTGGCGCGAGCACTGGACCGAGACGGTCAACGTGCTGGACATCGGCGTG
TCGGAGTTGATTGACACTCATGATGTCGTAGACAAGAGTCCCGAAGGGGCTGTACGTGGAGCGGCACGTAATCCGCTGAGCGGGACTCGTTGTGATAACG
AGCCATCGCTGCAGGCCGCTGATGGCATGGTCGGCAGAAAGCCGAGGCATCGTGGGCATAGCCCTGATGATGCGCGTGGAGCGGCACGTTATCCGCTGAG
CGGTGACGCGATGGCGAAGAATCGCTGCGTGCCAACGATGGCGCGGTCGGCCACGAGCCGAGGCATCCTGGGCCCAGCCCTAACGATGCGTGTGGAGTGG
CACATAACCCACTGGGTGGGGACTGCGAGCTATGCAGCTCCTCGCCGGATGTCGAGTTTGACGTCGACGCTCCGATGAAGCAACAAGAGGTGGAAACACC
TGAGGACACCTTTGGTGTGAATATGCAGGCCTCCCCGAGGCGTATGGTCTCCGCGAGGAGACGGCAGCGACGCCGTGTGGCAGCTGCGAGACGCAAAGCG
TCTGTTATGACACAGCAAGTGTCGGGAGTGGTGGATAGCGAACAGCTATATACACTCGTTAATGGAGTGACCGGCGAGGTCGCTGGCGACGTCAGCCTTG
AGGCTGTTCCCGCCGCAGATGCTCTGCTAGAGCTGGACGAAATGTCAATTGCCGAGTTCGGCGAGGCCTTAAAGGCGGGCGAATTAGCCGAGGTCGCTAT
TATACGACCTGAAGATGAGTTAAACTCGTCGTCCCTTATGGACGAAACAGTCCTGGAGGACACGAAGCAGGCGCTTAGTGCGCGTAGTGGATCGGCGATC
CTGAAGGATCCTTCAGATCCGTACTATCCCTTGGTTAAGGAATACCAAGATGTCGTTTCCAACGATCCGCCTTCTGGCCTACCTCCAGATCGAGGCGTGC
GTCATGAGATTGACCTGGTCCCTGGAACCAAATACTGCGTAACAAGGCAGTGGCCCTTGCCAAGGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGC
GAAACACGAGGCGGGCATGGTGCGCGAGAGCAAGTCTCCGCACTCGACGCCGACATTCTGTGTCAGAAAGTCAAACGGCAAGTGGCGCATTGTCCACGCT
TTCAATAAGCTCAATGCCGCCACCATTCCGGCGCAGACGCCTATTCCTAGGAAGGATGTTCTCCAGAACAACATGGTTGGATGCACAGCATACAGTGCGC
TCGACTTAGTCGATGGTTATTACCAGTTGCTCATGCGTGCGAGCGACATTCCGCTGACAGCGGTCAGCACCCCGAGCGGGATGCTCTGGGAGTGGTTGGT
GATGCCCCAGGGGCTGTCGAACGCGCCCGCGACGTTCAATCGTCTAGTGACGCAGCTCTTCCGGCCCCATCGGGCGTATGCACAGACATACTTCGACGAC
ATTTTCGTCCACAGTCGTGCCGAGCACGGGAAGTCAGATGTGGACAACCACATAGACCATTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGCTGT
ACG