Description :
From Genome Similarity Track
Location :
Scaffold_5:52121- 54010
Transcript NameFunction/comments
Sapdi_VS20SDRG_02173hypothetical protein

Sequence
1889 bases(100 bases per row)
TTGTGGCCATTTCAGCGACTCGGCTCTCCGCATCAATGTAGAACTGATGCACTTACTGTTAAACCACTAATTTGAGAGTGAAAAAGCGGCGCGAAGGGCC
AGGTATGGGAAACTCTGACACCTGGCAATGAGATTCTACTGCGGCTCGGTAATATACATCAGCTGCAAGCGGACTGGGCTATTGCACTGGAAGGGCGTAC
TGTGGACATCCAACCTCAATGCGATCGTGGTGGCGAGATCCTAAAACGCTTGCCTCGTTCTGATTGGCGCGAATTCAAACAACACGTCTCTCGGATTGGT
CCAAAAAGTTGAAAAATACAACTCCAGGATCTAAATTACCTTTGTCTTTGTATACTTTCACACGATATTACTATTTAAAAAGATGCCAGACATCGCTGTC
ATGTAATTTAATTAAAATAGCCTAGCGTTTATATACCATACAAATACCAGCTATCGGGTATCTTGAGTCGCTCAGTGTTCAAGCCACGCTTCCAAACCCA
CATCCTCCGCGCCGCCCGCCCGCGACCTCGCCTTCGCCATGCTGCTGCTGCATGACGCCCTCGCCCACCCCAAGTGGGTCGACCACTTCGTTGCCAAGGC
GCACTCAACGGGCGCAGTCCTCGAAGACTTGCAGCTTGAGAAGCTCCAGGACGTCCTCGTCGCGTCTGCGGGCGGCGACGCGAAGGCGACAACGGCGCTC
ACGGCCGCGTCTGCTGGCCACATCTTAGAGGGCGTTTACTTTGCAGTCGCCCATATGGCCACGTTGCGCGAGACGATGTGGGGCGGCTGCGACGACGAGT
ACCGTATCTTCCACAAGCGACGACGGTCCGGCGCGACGCCGCGGCCCTTTCTCTGCATCGCGCGGTCGCCCGAGTCGCGCAAGACTGGCCTCAGCCGCGT
CGACATGGTCCGTGCGTATGGCAAGCCTGGGCGGTCGGCGATTGTTATCTCTGCCCAAGTCGTGCACGCCGATCGCGCACGCCACCCGCTGCGATGGCAC
TACTTGTGCCGTCGTGCTGCAACAGTGGCGCAGTCTGATCTCCCGCCTATCGTCAAGCTTGTGGACTTGACGCAGTGGAAGCGCGTGCTTAGAGTCCTCG
ACATGGACCCCACTCTTCGCTGCACCTTTCTGGCCAAAGTGGCCGCGTATGTGTTGCTGCTCGCGCAAGTACCGGCGCCACTCGTGCCCATGGCTCGGAC
TGCAATCAAGCGTTCTACGCCGTCGACACCCACGCGTCGTCTCGCGCGCCCGATCAAGGCGATGCGCATGAGCCCCAGCAAGCACGGCAGCAAGCAGATC
CTGGCGACACGTCGTTTGTTGATCACGACGACGAAGGCGCAGCGCACGACGCCCGCCGCCGCATTGTCGTGTTCGTCCGAGCAACTTGCATCGCTTCTGC
AGACCACGATCGATGGACTTCACCAAATGCAGACCCAGTTGAAGCTGCTCACAACGACCGTGCTCACAACCAGCGTTCAACCCGCCATGAAGACGCAGCG
TCGCCGCCACTCGTCCTGCAACTAGGTAGCTAGTGCTTGGTTGTGGTTGTCCAGATAATACAAGAGACGGTTTTGAATGCACCTGTTATCCTTGGCGTCC
TGTAGTCTGATGTCTCATGACCACTGATTCAGACATGGACCTTCGTCATCACTATGACTATCTTTGTTGCGAACATGTTGGACTTAAACCACGAATCAAC
CTAATTCCGCAAGTAAACAGCTGGCTTCAGGGGGGGCGGCATAGCGATACCAGAGGAGAAGACTCTCGTGCAACGACGGACTTGGTGTAGTTTTAGCCCT
TGGTCGTATCTCAAGAGAAATGAGCTCGGCCACTAGAATGGCAAATTGCTGAGACCGTTCTTGGATCGGTAACGACGCGCTGTGATTGG