Description :
From Genome Similarity Track
Location :
Scaffold_147:52110- 53993
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_15108Hypothetical protein

Sequence
1883 bases(100 bases per row)
AACGCAAGGCCTCCAAAACCACCACGTCGACACCGGCGGCGTGCGACCGTCTTCACGCTCTCGCACGCACCCGCAGTGAGTGGCGCGCGCGGGAGCTCAA
GCGCAAGGAGGACGACGTCACCCGCGAGATCGAGTCCCGCAAGCTGCGCCTCGCCGAAAAGTCCAAGGCGCTCGTTGCGAACCGCACGAACGGCAGCCAC
CGGTCGATTGGCGATCGGCTCCACAGCGAAGCGCTCTCTGAGGCCGCGCGCCGGGACAAGATGGCGGACGCGCGGCGGCGGGAGAAGGAGGCGCAGATCG
ACTGGATGTGTCCAAAGTGCGCGCACGTCAACAAGTTTGCTGACAAGACGTGCCAGAACCGAACGATCAAGAGCGGTCATCGCAAGACGACGAGCAGCAG
CAGCAGCTCGAAGCCAAAAGGCGTCTGCGGCATGGCCAAACCCGTGCTCTTCACGCCGACCTTGCTCTCGGCCGCGCCGTCCAAGAAGGCCGAGGACTCG
GAGCAGCTCCTCGTGCGACGACAGAAGCACCAAGAGATGGCCCAAGCGCTGTACCACACGACCCACACGTTTGCGCCGCAGCTCAATCCCAACTCGCAAG
ACATTGTGCGCGAGAAGCGCGGCGAGGCGCACGACGCCTACGCCTCTTTGTACGACGACGCGCGCACCCGTCGCCAAAAGCAAACCGAGAAGGAGGCTGC
GTACCTTGCGTCGATTCCGTTCAAGCCCGACATTGGCTTGCACACGCCGGGCGGTGGCGAGCATTGGGTTGACCGCCTCGCGGTCACGGACAAGGCGGAC
GCCAAGCGGCGCGACTTGCTGGAGAAGTACGGTGCCGCCAAGGATCCGGTGACCGGGCGCCCGCTGTTCACACCGGACATTGGCCGCCCGCCGCAGTTCC
CGCGCAACGACACGAAGCTCCCGATTGGCGAGTTTTTGTACGAGTCGCGCCACGAGGTCCGCGCGCTGCGGGCGACGCTCGAGGCACAAGCGGACGCGCG
GCGCAAGGCGCGGCAGACCCAAAGCTTCCTCTCGTCCACGTCCAAAGCCATGCTGGAGGCGCGCAAGGCCAAGAGCTACGACGTCATTTATGGTCTCTTG
CAAGTGGCGTGTGGCGAGCCCACCGACGCACCTGTCTTCGACCCGGCGAAGCTCCCGACCGACGCACTGCCGTCCGACTTGAGCCACATTGCATCGAGTC
TCTTTGACGTCTGTGGGTTTGAGAGCATTCCCAGAGCCGAGTTCTTCAACTGCATGGAGACGACGCTCACGCAGTCGCCGGGCCTCACGCACACGCAAGT
GCTCTTCTTCAGCGACAAGCCGCCGGCGACGTCAACGGCAGCGCTCGCGGCCGCCGCCGAGGCCAAGGAGCTCACGTTTCGCCCGAAAATCAACCCGGCG
TCCAGCACGATCGAGCGCCGGGACAAAGATATGAGCGTCTTTGACGCGCTGCACCAGTATCAAAAGACATACGAAGCGAAGCGCAAGGCCAAGCAAGCGC
AGGTGGACGAGGTGCGCAACAAGGCGTGTCCGTTTACGCCGACGCTTGTGGCGAAAAGCTCGCACCTCTACAGCATGTACGACAACCTTCCGGACGACGA
CAGCTTTGACGACGACGACGCGGTCATTCTCCAAACCTCCAAGCCCCTCGCGCGCCCTTATGTGCGCCCGCTCGACGAAGAGTGGCCCGTCGAAGAGCCG
CTTTTGGTCGTGAACCGGTCGCCCGTCGGCCCGACGCGGCCGCAGCTGCTCATGTTTGGAGAGACGCCGCCTCTAGAGAAGGCTGCATCGGTCGAGCCGT
CAGTCCAGCACCCGGTGGTCGGGGGAGATGGCAAGGACACTGCGATGGACGATGCGTACGAAGACGAGGACGATGCAGCGACC