Description :
From Genome Similarity Track
Location :
scaffold_17:521090- 523094
Transcript NameFunction/comments
Plaha_PHALS_11153Ubiquitin-conjugating enzyme E2-binding protein
Plaha_PHALS_11154deoxyhypusine hydroxylase-like isoform x1

Sequence
2004 bases(100 bases per row)
CCAAACGATTGTGGAGTCGTTTGTTGAATATCAAGTAAATATTGGCTGTTATCAATGTTATCTCTATTTTACTCGAACTGTACCACTGGATATCACGAAA
TGTACCATTCAAGGTACATTTTCACGGATTGCATTGGTGTACCCATGTGAGaatgatgatgaagttgGTACAACGACTCAAGTACTTTGGTATCTTGATA
TTAAACAACATGTTGACATTTCAACTTGCACAATAGAAGACAAGAACGATCATTGGTACATGCGTCTTCCCGTCCATTCAAATACATCGCATGGTTTCTC
GTCAATCTCAAGTCATGAGTTAGAAGCAGAGAATTATGGTACAATTTCATGTCGAACTTGTACCATGCCATTGGTACACTCGAATATTATTAACAAAGTC
TTGCCATTACCATCTACCAACTGGATGGATATGTTGGACTTTTGGGGAGCTGGAGATGGTGCATTTGAACATATTCCACGTGAAGGAATTGTAGCACAGC
CGCATCGTGTGCTTGTAGGTGAGTCTTTTGTATTACTACATGTTCAAGATTTTCTGGTACATGCTATTGTGGCACATGGTACCACAACAGAGGGGGAATG
GGTACCATTGAAATGTACCAAATGTTGTGTTTCAATTGGTTTGTCAAGTTTCGATCATGTTGAAACTATTCGTCTTGATAAACATTTGATACATGCTTCA
AAGAATACAATGACAAGTTTGGAGGATCAAGAGAATGTTTTTGCAACATATACTGTTGATAGTATCGTATGTGCCAAAATATTGGAACAAGCAGATGCTG
ATGGTACCTTTCGTTTTCGTTTGACAACTGGTACACTTGGTACCTCGATGAATTTACAACTTTTAAGTTGGAATACCCTGATCAAACATCGTCATGTCCC
AACATTTCGACGTGTACTCAAAGTATTGTACAAACATGATCAAGTCTTGTCCGATCATGCGTACGAAATTCATCTTTCAACTAATATGTACGCAACGATC
GTCCAGCGACTTCAAGTGAGTACAACATTATTACCAGTTTCATTACAAACATTTAATCAAATGTCAATTGGATATTTGTACGCATAAGTAAATacaaaat
tttcaagtcaTCGTACAAACACTTAAGATTTGATTTCATTAGAAGCCCAATAGTCCATAATATCTAAAGCTACTTGACAACTTTCACGTACAACTTGAAC
GTTATCATTAAGATGATGCGTTAAAATCTTCTCACATTCAATTGTACCAATTGCACCTAAAGCTTCAGCTGCTTCATGTCGTACCATTCGATGTTGTGTT
TGATCAAGTAAAACTTTGGTTAAGGCTGGTACAAGCACTGGATTTGCCATTTGTCCCATTACATAAGCAACTTCATGTTTCAAAAGTGTATTTGAATCAT
CAAATGCTTCAGCAAGAGCTAAAGCTGCTTCGTTTGTATTGCGATTTCGTAGTGAAAATAATGCACGGTACCGTAAAAACATGTCCGCACGTGGATCCAA
CAAAATGGTACGTAGTTCCACTGTTGACATGGTCATTTCGGCAGCTGGTGCCGGATCTTCTGATAAGTACGGATTTTGATCCACTTGAGCTTCATGAAGT
GTACCATTCGCTTTGGCACTTTTGTAATGTACCAATTTAAGTGCCAATTTACACGTTTCCGAAATTTCAGGTGCGGGATCGTGACAATATTTTTCTAAAA
TTGAAACCGAATGTACCGATCCAATGGCACCCAAAGCTTCTGCTACTTCATGACGTACCATCACATCGTCAGTTTCATCTGCCAATATTTCATGTAATAT
TTCACAAGCTTCtttcttttgaaattgaCCAATAACATACGCCAATTCATGACGCATAAGCTCCGAGTCTTGACGATTCTTTAAGGCTTCAAGTAAAACT
TCCAAATCTTCCAAATTTCCACGGGTACGAAGATAAAAAATTGCACGTGTACGTTTACCAATTGGTTCAGTAGGATTGAGTAATGCAGTGCAAAGTTGGT
CAAA