Description :
From Genome Similarity Track
Location :
contig_28:521078- 526352
Transcript NameFunction/comments
g6680.t1hypothetical protein

Sequence
5274 bases(100 bases per row)
CGAGCTGCTGCAGGGCAAGTTCGGCTTCCAGCGCAGCAGCGTGGCCAACCAGAAGGAGAATTTGGGCTGCTGGATCACCAACTACCAGATGCGCGTGCGC
GCCGAGGCCCCGCAAGGTGCCGCCGAGAGCAGCGACTTCGTGACGCGCACCGCGCTCGCCCGCGTGCACAAAAAGTTCTTCAAGAACTACGTGGCTTGGT
GTAAGTTCCTCCGCGCGCCACCGCGCTGCTGCGACCCAGAGAAGGACGCCACAGCCAAGACGGAGAAGGAGCTGGTGTTGTTCTTGCTGCTCTGGGGGGA
GGCCGGCAATTTGCGCTTCATGCCCGAGTGCGTGTGCTTCCTGTACCATAATATGGCCAAGAAGTTGGACTTCCTGGACACGCTGCAGGACGTGGACGAG
GGTTTCTACCTCAACGAGATTGTGCGCCCCGTGTACGGCGTGATTGCCAAGATGCGTACAGCCACGGCACCCAAGGGCGAGCGTCCGTTCGACCACCAAG
ACACGACCAATTATGACGATATCAACGAGTTCTTTTGGACAGATAAATGCCTCGAAAGCGACGAGATGAACGTCGCGAAAATGCTGGAAGTGCACGACCC
CAAGACGTTCAAGGAGAAGCGCAGCGTGTTCAACCCCGTGCTGGCGTTCTTTAGGGTCTGGTACTTTTTGGTTGTGGTCTTTCACGTCCTCGTGGTGGTC
ACGTACGTGGCGTACATGGCCGAGGGCGACGACGACGGAGGCCTGGGCTTCTTTTTCCGCATCTTTGACAGCGGCCAGAACAAGATCCGCGCACACGCGT
TCTACACCATTTTCATCACCGTCACGGGCCTGCTGGCCATGAAGGTGGTGATGCAGATCTGGCTCTTCGGCCTGAGACTCTACAAGGACGTGTGGATGGC
CGTCGGCGTCTTCTGCAGGCTGTTCTGGCACACGCTCTTCTTCGCGCTGTTCATGGCGGTCAACTTTTCGCCGGACGGGTCGGCGGTGCTGGGATCTCTG
AGCAGCATTTTGCCAGGAGGAGGCACTGCCGGAACGTACTTGTCCATGGGGCTGATGTACATACTGATTTACTGCATTCCGGTGCTGCTGGCGGCCACGA
TCCGCGCGTTCTTCCCGAACGCGATTTGGGGAATTCGCATTGTGAACGCGCTGGATGGTACCAGTCGACAGTATGTGGGACGCGACACGGCGCAACCCTG
GAAGGACTACTCAAGGTACTCGATGTCGTGGTACATCATCTTCTTCTGCAAGTTCCTGTTCGCGCTGCAGTTCATGATCCGGCCGTTGATGGCGCCGTCG
ATTGAGATTTATGATATCACTGTCGATGACGATGGCGTCTTCCAATCGGGGCACAACATCATATTCATCATCGCGCTGTGGGCCCCCATCTTCGTCGTGT
ACATGTACGACTCGCAGATTTGGTTTATCCTGTATCAGTCCCTTGTTGGGCTCGTGATGGGAAAACGCATGCACCTTGGCCACTACGTGGGATTGGCCCA
ACTAAAGAAGGGAATGTCGGGGGCACCGAAGCTCTTTGATGAGAAGGTGGTGTCTCTTAAAACCAAGACGCCCAACCCGGAAGCAGTGACGCCTGTCCCT
GGCGGTGGTGATGCTGGAGAGCTCCGCCACCGCGACGTTGTGCGCCTTCGTTTCGCGATCATTTGGAACCAGGTGGTGATAATTTCCGCTTGAATGATCT
GCTCGACGATCGTGAGACTGTTATCTTGCAGTACCGTATCCTGGACAAGGGTGAGCGGATCCAGGAGCCGATCTTCCTGCTGGCTGGCAAGTTGTCAAAG
GCTGTCGATGTTGCAGCCAAGTCGCGTTCTAGCAAGTGGGACACCGCAACTTTAGTTAAAAACATCGCTACTGCAGACGCCCTGGAAGGCATGAAAATGG
GCTGGAGCTTGTTCGAGATATCTTCTATTTGCTGCTTGGTGAGGACGAGAAGGGTGCGCTAGAAGTGCTCGAGTATATCTACTCGTCGCCGGACGTCGTG
AGCCTGGTCGACATGACCTACTTGCCTCAGCTTGCGGATAACATGGTCGAGCTTCTTGCCGTGATCTTGGATATGCCGGAAGATATTTCGGCGATCGACA
CACTGGAGTCTACACCCGAGGAACTGCGCATGGAACTCCACGTGCAAGTCGCGCAAGTGGTTGACCGCCTGCGCGCCATTGCGCTGACACTAGAGCTGAT
GCTGAACGATGATACCGTCTCGCGCAAAGTGCACAACTGCCGCTTCTTGCAGACCACGGCCGACCTCGAGTTCCAGACCCAGCAATTGATATACCTCTAC
AAGGCTGATGCTATGGCTGAAACTGGTCTGATCGCTGTTCACCCACGGGAGGGACCTGCTACGCCACCACAGCGCTTTAACCCGGAGGACTTCATTTCTA
GCTGCACGCGCTTATTCTTCTTGCTCCGCTTGGATGTTGCGAGTTCGCTTCCTCGTTGTGAGGATGCCAAGCGTCGCATGGGTTTCTTCCTCCACTCGCT
GGCGATGGAGATGCCCCGTGTGGACTCGATGGAAGCCATGCCATCATTCTCCGTGATGACTCCGTACTACTCTGAAACCGTATTGTTCACTTTGGACGAG
CTGAACGACCCTGTACACTCCAACCCGCTGTTCGCAGAGCTCGAGAAGAAGCAGAAGGCCAAGGGCTGGACGGAGCTGACGATCATGAAGTATCTGATCA
CGTTCCACGCTGAGGAGTGGAGTAACTTTCTGGAAAGAATGGGTGCTACCTCGCTGGATGAGGCTCTTGAAATCAATCCGACCGAAGTGCGGCTGTGGGC
TTCGATGCGAGGCCAGACGCTTGCCCGAACAGTTCACGGCATGATGCTGTACGAAGACGCCATCCGTCTTTTACGTTGGCTCGAGGTGTATTCTCTCCGT
GATATGAGTATCCAAGATAAGCTGGAGGAGATGAACCGCATTTCTGCACTGAAATTCTCCTACATCACGGGTTGCCAGATTTACTCCAAGCAGGTTGCGA
ACGGTGACCCTCGTGCGGCAGATATCGACTACTTGATGAAGTTCCCGAGCTGGCGCGTCAGCTTTGTGGACTCTATAACGGAAAAAGACGGCGACAAGGA
AATCAACCGCTTTGACTGTGTGCTCGTTAAGGCCGAAGAGGGAGAAATTGTTGAAGTCTACCGTTACGAACTGCCTGGTAACCCGATTCTGGGCGAGGGT
AAGCCCGAAAACCAGAACGTGGCATTGCCATTTACGCGTGGTGAGTACTTGCAAACGATTGATATGAACCAGGAGCACTACTTGGAGGAGTGCCTAAAGA
TGCCCAACTTCCTGGCGACTGCTACGAGCACCGGTGAGGAAGTGACTGTGATCGGTATGAAGGAGCACGTCTTCACGGGCCGTGCTTCATCGCTGGCGCG
TTTCATGACGCTCCAGGAATTGGTGTTCGTGACGCTGACCCAGCGTGTGCTGGCTAAGCCGCTTCGTTCGCGCATGCACTACGGCCACCCCGATGTGTTC
GAGAAGTCTTTCGTTGTACAAGCGGCGGTGTGTCCAAGGCTAGTAAGGGTATCAACTTGTCGGAAGATGTGTTCAGTGGCTACAACGTCACTCTTCGTGG
CGGCTTGGTGACTCATGTTGAGTTCATGCAGTGTGGCAAGGGTCGTGATGTGACGCTGAGTCAGATCAATGCGTTCGAAGCGAAGCTGTCCAATGGTTGT
GCTGAGAGTTGTCTGAGTCGTGAGGGTCACCGCCTGACCAACGCATTGGATTTCTCGCGCTTGAATTCGATGTTCTACGGTCACTTTGGTTTCTACATCT
GCAATGCCCTCACGGTGTTATGCGTGTACGTGTACGCGTACTGCAAGCTGTACGTTGCAACACACTCTGAGGTGGAGATCACGGCTATCATGAAAACGGG
CAGTCTCGACTCGCTTGCTAGTGTGATGACGACGCAGTATCTGCTCCAGTTCGGCATGCTGACCACGCTTCCTCTATTCGCGACTCTGTTTGTTGAGTTT
GGCTTCAAACAAGCCTCCCTGAAGGTGATTGAGTTGGTTTCGACTCTCGGCATTGTGTTTTACGTCTTCTTGACGGGCACGAAGGCTCACTTCTACGACG
TGGCACTTATTCGCGGTGGTTCGAAGTATCGAGGTACTGGCCGTGGTTTTCGATCACGCGTGACCCGATGGTGAACTTCTTCAAGGAGTATGGTGTTTCC
CACTTCCGCAAGGCTGTCGAGCTAATCGGTGTGATGATTTTATTCGGAATCTACGGCTCGTTCAACATCGGATCTGATGCGCGTGACGAGTACTGCGCGA
CAGCGGACTTCGATTGCGATACCGACCCGGACTTGATCCCTGCCAACATCACGTCGCTTGCAGCTTTCAGCACCACGTCTCAGAGCTACGGAATTGCTCA
TTTGCTGTGTTGTTCCTGGGTGCGTGTTGGTTGATGGCACCCTTCGTTTTCAACACGGATGGCCTGGTTCTCCAAAAGTCCAGGGTGGATATCGCCAACT
GGTTCGCGTGGATGATGCGATCGCGCCACAAGGAAGACGGAACCGACGAACACACTAGCAAGGACGCAAGCAGTGCTGCTTTGCAGCCGAAGGATGGATG
GGACGATTGGTGGAAGTCGGACGTGGACTTAATGGTGCCTCTGGGTGGAATGGGCCGGCTTACGTATTGCATTCGTGAGCTGCGTCACCCGTTGGCTATG
TACTACGTCTTCCTGACGGAGTTTACACTCCCGTGGCTTGCACTGCTGTTCGGCGCGATGGGTGCTACGTGGGTGCTGCTCTGGTTCGGAAACCGCGTGC
ACCACTGCGTCTCGAAGCACCGCAAGCTGAATTCGCTCGCGATCCAAGGAATCTTGTACATGATCTGCGTCATTGGAGGCATCCTTCTGGTGCCGCTGAT
TATTGGGGCCATGGGCGGTTGGTCTGTGCAGAAGTGCTTCACGTTCTCCATTTCGATGTTCTTGGGCTTCAACTCGGTCGTACAGTACGCCATGGCGTTC
AACGGTGCTTTCGGAATGGAAGTGGCTATGTGGAGCCCCATCATGGCGCTCGGCTTCCTCATGGACATGATTGTCGGCCTGTTCCTGGTTATCCCGCTGT
TCCTGCTGTCGCTGCTGCCGTTCATGCGTATCCTCCAGACACGTGCCATGTACAACGGAGGCTTCTCGCGTGCACTGAGCTCTGGCTCGGAGGTGGCGGC
TTCGTTGGTCATCCTGCTTGGTTTGCTGGGTGGCTTCATCCACGGCTTCATGACGTCATTCCTGTTCACGCTCG